N16 is a protein from the nacreous layer of Pinctada fucata, a pearl oyster. It has been found to promote biomineralization, and we hypothesized that it also plays a role in bone metabolism. The cDNA of N16 was cloned and expressed in Escherichia coli to produce N16 protein, which was purified to high homogeneity by ion-exchange and gel filtration columns. The effects of N16 on osteoclast differentiation and osteogenesis were clarified using the murine preosteoclast cell line RAW 264.7 and the preosteoblast cell line MC3T3-E1. Results on preosteoclasts showed that N16 only slightly inhibited cell survival but significantly inhibited differentiation induced by receptor activator of nuclear factor kappa-B ligand (RANKL). Apart from reduced formation of multinucleated osteoclasts, N16-treated cells exhibited lower gene expression and enzymatic activity typical of mature osteoclasts. Actin ring formation and intracellular acidification essential for osteoclastic function were also impaired upon N16 treatment. At concentrations nontoxic to preosteoblasts, N16 strongly up-regulated alkaline phosphatase activity and increased mineralized nodule formation, which are indicative of differentiation into osteoblasts. These effects coincided with an increase in mRNA expression of osteoblast markers osteopotin and osteocalcin. The present study demonstrated that N16 has both anabolic and antiresorptive effects on bone, which makes it potentially useful for treating osteoporosis.

BackgroundPeroxisome proliferator-activated receptor-gamma coactivator-1beta (PGC-1β) is a transcriptional coactivator that plays important roles in regulating multiple aspects of energy metabolism and cytokine signaling pathways. We have reported that down-regulating PGC-1β alleviated the proinflammatory effect of rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLS). Recent study reported that osteoclast formation and bone resorption were markedly suppressed in PGC-1β knockout mice. However, the role of PGC-1β on the osteoclastogenesis in RA has not yet been illuminated.ObjectivesTo investigate the effect and underlying mechanism of PGC-1β on RA-FLS induced osteoclastogenesis and bone resorptionMethodsSynovium was obtained from 3 active RA patients and cultured RA-FLS was identified by flow cytometry using CD55 antibody. RAW264.7, used as precursor of osteoclast, was cocultured with RA-FLS or human RANKL. Gene knockdown was performed by lentivirus short hairpin RNAs (sh-RNAs) which were cloned into pLKO.1 (GV248) lentiviral vectors. The sh-PGC-1β targeting sequence was GGAGGAGGAAGAAGAAGAATT, while sh-GFP was regarded as negative control. Culture supernatants containing sh-RNA were added to RAW264.7 in the presence of polybrene. Stable cell lines were validated by western blot. RAW264.7 transfected with sh-PGC-1β or sh-GFP was cocultured with RA-FLS in 6 well-plates with transwell plates. At day 14, osteoclasts were identified as multinucleated cells that contained >3 nuclei with positive staining of tartrate-resistant acid phosphatase (TRAP), and protein of RAW264.7 and osteoclasts was extracted for western blot determining the phosphorylation of ERK, JNK, p38 and NF-κB. At day 21, resorption lacunae area was identified by toluidine blue staining and measured by image analysis system.Results(1) Flow cytometry results showed the purity of cultured FLS was over 90%. TRAP staining showed osteoclast formation in both cocultrue system of RAW264.7 with RA-FLS or human RANKL.(2) The protein expression of PGC-1β in RAW264.7 transfected with sh-PGC-1β was hardly detected compared with negative control (Fig. 1C). At day 14, down-regulating PGC-1β of RAW264.7 cells could significantly decrease the number of osteoclasts compared with negative control [(1037±356) vs (237±110) per well, P=0.021, Fig. 1A]. At day 21, down-regulating PGC-1β of RAW264.7 cells could significantly inhibit the resorption lacunae area on bone slices compared with negative control [(25.33±6.50) % vs (10.67±5.51) %, P=0.041, Fig.1B].(3) The protein expression of p-NF-κB from RAW264.7 and osteoclasts was significantly down-regulated in sh-PGC-1β transfected group than sh-GFP transfected group, but not p-ERK, p-JNK or p-p38 (Fig. 1C).ConclusionsOur results implied that down-regulated PGC-1β could inhibit RA-FLS induced osteoclastogenesis and bone resorption by suppression of NF-κB activation.AcknowledgementsSupported by Grant support was provided: National Natural Science Foundation of China (81471597), Specialized Research Fund for the Doctoral ...