Rice stripe virus (RSV; genus Tenuivirus) is a serious threat to rice production in Korea (2). In 1965, a disease outbreak was observed on rice in South Korea, with plants showing yellow stripe symptoms (2). Reoccurrence of RSV in rice was observed again in 1980 in Gyeonggi and Chungcheong. In 2001, RSV was estimated to be infecting approximately 4,663 ha of rice in the provinces of Gyeonggi and Gangwha and approximately 5,000 ha of riceland in the provinces of Buan and, Seocheon (3). Proso millet (Panicum miliaceum L.) is grown as a cereal grain crop and used mainly for human food in South Korea (1). In June 2009, proso millet plants that displayed yellow stripe symptoms were collected at Sinjeon-Myeon, Gangjin-Gun, and Jeollanam-do provinces, where an outbreak of RSV in rice was reported. Diseased plants tested positive to RSV with an ELISA Kit (KisanBio, Seoul, Korea). Total RNA was extracted from leaf tissue with an RNeasy Plant Mini Kit (Qiagen Inc., Valencia, CA). RSV coat protein specific-primers were produced (5′ TGTGGAACATAGTCCCACAGTAAGT 3′(upstream), 5′ CTAAGCCGCAACCATTCCTCCAGT 3′(downstream). Reverse transcription-PCR confirmed the presence of a 494-bp product as predicted for the presence of RSV. The coat protein of RSV isolates collected from proso millet, rice, and foxtail millet in the same area was also sequenced. Results confirmed that phylogenetic relationships were of high homology: 98.9% between RSV isolates from rice and foxtail millet, 99.2% between isolates from rice (GenBank Accession No. JN245626) and proso millet (GenBank Accession No. JN245627); 99.6% between rice and foxtail millet (GenBank Accession No. JN245628); and 99.6% between foxtail millet and proso millet. In addition, sequence comparisons showed 96 to 99% identity with known RSV sequences available in GenBank (Accession No. X53563) (4). To our knowledge, this is the first report of RSV of proso millet in South Korea. The finding of this disease confirms further spread of the virus within the northern part of South Korea and the need for research to develop more effective management options to reduce the impact of RSV in proso millet. References: (1) Y. Y. Choi et al. Biosci. Biotechnol. Biochem. 69:31, 2005. (2) B. C. Lee et al. Res. Plant Dis. 10:30, 2004. (3) B. C. Lee et al. Res. Plant Dis. 14:210, 2008. (4) Y. Zhu. J. Gen. Virol. 72:763, 1991.

Antibacterial bone biomaterial coatings appeal to orthopaedics, dentistry and veterinary medicine. Achieving the successful, stable conjugation of suitable compounds to biomaterial surfaces is a major challenge. A pragmatic starting point is to make use of existing, approved antibiotics which are known to remain functional in a stationary, immobilised state. This includes the macrocyclic glycopeptide, teicoplanin, following the discovery, in the 1990’s, that it could be used as a chiral selector in chromatographic enantiomeric separations. Importantly teicoplanin works at the level of the bacterial cell wall making it a potential candidate for biomaterial functionalisations. We initially sought to functionalise titanium (Ti) with polydopamine and use this platform to capture teicoplanin, however we were unable to avoid the natural affinity of the antibiotic to the oxide surface of the metal. Whilst the interaction between teicoplanin and Ti was robust, we found that phosphate resulted in antibiotic loss. Before contemplating the covalent attachment of teicoplanin to Ti we examined whether a commercial teicoplanin stationary phase could kill staphylococci. Whilst this commercially available material could bind N-Acetyl-L-Lys-D-Ala-D-Ala it was unable to kill bacteria. We therefore strongly discourage attempts at covalently immobilising teicoplanin and/or other glycopeptide antibiotics in the pursuit of novel antibacterial bone biomaterials.