biochemical and histological improvement. 3,4 Several factors Hepatitis C virus (HCV) genotype 1b and high precan predict a poor response to interferon therapy, e.g., high treatment virus load are predictive factors of poor repretreatment virus load, genotype 1b, advanced histological sponse to interferon therapy in patients with chronic changes, lower serum ferritin level, and a high degree of hepatitis C. To further examine the factors predicting amino acid substitutions of the hypervariable region (for rethe response to interferon in patients with genotype 1b view, see Davis 5). infection, we analyzed 110 consecutive patients withRecently, Enomoto et al. 6 compared amino acid sequences HCV who were treated with a total of 624 million units of of interferon-sensitive and -resistant quasispecies by analyzlymphoblastoid interferon alfa. Thirty-six patients (33%) ing serum samples of three patients infected with genotype were responders, while the remaining 74 patients (67%)1b HCV before and after interferon therapy. They identified were nonresponders. Multivariate analysis showed that in the interferon-sensitive strains of HCV clusters of amino a high virus titer (assessed by serum core protein level, acid substitutions in the carboxyl terminal half of the NS5A P Å .0021) and the presence of more than two amino acid region (codon 2154-2383). They also detected multiple missubstitutions in the interferon sensitivity-determining sense mutations exclusively in a 40-amino acid stretch (coregion (ISDR) (P Å .0036) correlated significantly with don 2209-2248) in interferon-sensitive HCV isolates. 6,7 In the response to interferon therapy. Because mutations contrast, the sequences of interferon-resistant HCV strains analyzed by direct sequencing of polymerase chain reacwere identical to those of prototype genotype 1b. They desigtion (PCR) products may reflect artifacts of direct senated the region with these amino acid substitutions as the quencing, we further analyzed quasispecies of HCV in interferon sensitivity-determining region (ISDR) 6 and this region by cloning and sequencing. Although PCRshowed, by multivariate analysis, that the substitution in based analysis of responders with multiple amino acid the ISDR was the best predictive factor of the response to substitutions in the ISDR showed the presence of a small interferon therapy. 7 These results were potentially of great amount of wild-type strain in their serum, the results importance but were based on relatively few patients treated obtained by direct sequencing and cloning were essenwith varying regimens of interferon. To provide further evitially the same. A longitudinal study of quasispecies in dence for or against the predictive power of amino acid substi-2 patients who showed a dramatic change in the virus titer showed no conversion from wild type to mutant or tutions in the ISDR, we used a large sample of patients with vice versa. Our results indicate that amino acid substitu-HCV genotype 1b seen in our unit who were treated with a tions and virus ...

TT virus (TTV) is a newly identified single-stranded DNA virus. We retrospectively analysed serum samples from sixteen patients, infected with both hepatitis C virus (HCV) and TTV, and who had been treated with interferon. An elevated serum alanine aminotransferase level after interferon was associated with persistence of HCV (abnormal in five of seven patients with persistence of HCV compared with normal in all nine patients who showed eradication of HCV) irrespective of persistence of TTV. Comparison of partial viral DNA nucleotide sequences and phylogenetic analysis showed that viral strains that had a high identity to the prototype virus were more resistant to interferon than those showing low nucleotide sequence identity. Although we observed no liver cell injury caused by persistent TTV infection, the mechanism(s) of TTV resistance to interferon should be further investigated for a better understanding of viral diseases and establishment of therapy.TT virus (TTV) is a newly identified DNA virus isolated by representational difference analysis from patients with acute post-transfusion non-A to -G hepatitis (Nishizawa et al., 1997 ;Okamoto et al., 1998). Although the characteristic features of the virus are not fully understood, the close association between DNA titre and alanine aminotransferase (ALT) activity suggests that TTV is the causative agent of posttransfusional hepatitis. In the initial report of Nishizawa et al. (1997), three patients with post-transfusion hepatitis were described. Based on their description, TTV seems to cause only a mild form of liver injury. However, one of the three patients showed persistence of the virus for more then 21 weeks after blood transfusion, indicating that TTV can potentially cause a Author for correspondence : Kazuaki Chayama.Fax j81 44 860 1356. e-mail chayama!mba.sphere.ne.jp chronic infection in humans. It is thus important to characterize the clinical course of TTV infection, including prevention and development of effective therapies.To study liver pathogenesis and susceptibility of TTV to interferon, we retrospectively analysed pretreatment serum samples obtained from patients with chronic hepatitis C virus (HCV) infection who tested positive for serological group 2 HCV antibody (Tanaka et al., 1994) and were subsequently treated with interferon (IFN). We identified 16 TTV-positive patients and examined serial serum samples from these patients for the presence of TTV and HCV.Virus DNA was extracted from 100 µl of serum sample by digestion with proteinase K and SDS followed by three extractions with phenol and a single chloroform extraction. The DNA was precipitated with 1n0 µg glycogen by absolute ethanol and dissolved in 20 µl H # O. Five µl of the DNA solution was subjected to PCR as described previously (Okamoto et al., 1998). Primers used for the detection of TTV were NG059 (sense : 5h CACCAGGAGCATATACAGAC 3h) and NG063 (antisense : 5h CTGGCATTTTACCATTTCCA-AAGTT 3h) for the first PCR and NG061 (sense : 5h GGCAACATGTTATGGATAGACTGG 3h) and NG063 for the ...

No abstract

No abstract

No abstract