Parkinson's disease (PD) is a neurodegenerative disorder that is pathologically characterized by the presence of intracytoplasmic Lewy bodies, the major component of which are filaments consisting of ␣-synuclein. Two recently identified point mutations in ␣-synuclein are the only known genetic causes of PD, but their pathogenic mechanism is not understood.Here we show that both wild type and mutant ␣-synuclein form insoluble fibrillar aggregates with antiparallel ␤-sheet structure upon incubation at physiological temperature in vitro. Importantly, aggregate formation is accelerated by both PD-linked mutations. Under the experimental conditions, the lag time for the formation of precipitable aggregates is about 280 h for the wild type protein, 180 h for the A30P mutant, and only 100 h for the A53T mutant protein. These data suggest that the formation of ␣-synuclein aggregates could be a critical step in PD pathogenesis, which is accelerated by the PD-linked mutations.Parkinson's disease is a neurodegenerative disorder that predominantly affects dopaminergic neurons in the nigrostriatal system but also several other regions of the brain. Two dominant mutations, A53T and A30P, in ␣-synuclein cause familial early onset PD (1, 2). The function of ␣-synuclein and the pathogenic mechanism of these mutations is unknown, but ␣-synuclein has been detected in Lewy bodies (3-5) and shown to be their major filamentous component (6). Lewy bodies are a pathological hallmark of PD (7-9), and we therefore hypothesized that the PD mutations would cause or enhance ␣-synuclein aggregation. Indeed, a very recent publication demonstrated in vitro fibrillization of A53T mutant but not A30P mutant or wild type ␣-synuclein (10). Here we demonstrate aggregation of all forms of ␣-synuclein. In a complete aggregation time course, we show that there is an aggregation continuum; although all forms of ␣-synuclein do aggregate, aggregation is accelerated for both mutants; A30P aggregates slightly faster than wild type, and A53T aggregates much faster. Because both mutant forms enhance the aggregation tendency observed in the wild type, we hypothesize that aggregation of ␣-synuclein may be important in all forms of PD. EXPERIMENTAL PROCEDURESCloning, Bacterial Expression, and Purification of ␣-Synuclein-A 536-bp human ␣-synuclein cDNA was obtained by polymerase chain reaction amplification from an adult human brain cDNA library using primers corresponding to nucleotides 20 -42 and 532-556 of the published sequence (11). Polymerase chain reaction-based site-directed mutagenesis of this sequence was used to generate the mutant forms A53T/ A30P, and A53T ϩ A30P. For bacterial expression, all 4 forms were amplified using the primers TGTGGTCTAGAAGGAGGAATAACATA-TGGATGTATTCATGAAAGGTCTGTCAAAGGCCAAGGAGGGTGTT-GTG and GGGACCGCGGCTCGAGATTAGGCTTCAGGTTCGTAGTC-TTGATAACCTTCCTCA to alter 3 codons near the 5Ј end and 1 codon near the 3Ј end to more highly utilized Escherichia coli codons. The resulting PCR products were digested with NdeI and XhoI and cloned int...

Human erythropoietin is a haematopoietic cytokine required for the differentiation and proliferation of precursor cells into red blood cells. It activates cells by binding and orientating two cell-surface erythropoietin receptors (EPORs) which trigger an intracellular phosphorylation cascade. The half-maximal response in a cellular proliferation assay is evoked at an erythropoietin concentration of 10 pM, 10(-2) of its Kd value for erythropoietin-EPOR binding site 1 (Kd approximately equal to nM), and 10(-5) of the Kd for erythropoietin-EPOR binding site 2 (Kd approximately equal to 1 microM). Overall half-maximal binding (IC50) of cell-surface receptors is produced with approximately 0.18 nM erythropoietin, indicating that only approximately 6% of the receptors would be bound in the presence of 10 pM erythropoietin. Other effective erythropoietin-mimetic ligands that dimerize receptors can evoke the same cellular responses but much less efficiently, requiring concentrations close to their Kd values (approximately 0.1 microM). The crystal structure of erythropoietin complexed to the extracellular ligand-binding domains of the erythropoietin receptor, determined at 1.9 A from two crystal forms, shows that erythropoietin imposes a unique 120 degrees angular relationship and orientation that is responsible for optimal signalling through intracellular kinase pathways.

Angiopoietin-2 (Ang2) exhibits broad expression in the remodeling vasculature of human tumors but very limited expression in normal tissues, making it an attractive candidate target for antiangiogenic cancer therapy. To investigate the functional consequences of blocking Ang2 activity, we generated antibodies and peptide-Fc fusion proteins that potently and selectively neutralize the interaction between Ang2 and its receptor, Tie2. Systemic treatment of tumor-bearing mice with these Ang2-blocking agents resulted in tumor stasis, followed by elimination of all measurable tumor in a subset of animals. These effects were accompanied by reduced endothelial cell proliferation, consistent with an antiangiogenic therapeutic mechanism. Anti-Ang2 therapy also prevented VEGF-stimulated neovascularization in a rat corneal model of angiogenesis. These results imply that specific Ang2 inhibition may represent an effective antiangiogenic strategy for treating patients with solid tumors.

No abstract

No abstract