IL-37 is an anti-inflammatory cytokine that was only recently identified, and it is highly expressed in tissues from patients with inflammatory and autoimmune diseases. Inflammatory cytokines and inflammatory stimuli can induce the upregulation of IL-37. However, it has not been reported whether anti-inflammatory medications induce the expression of IL-37. In this work, we uncovered, for the first time, that two main bioactive components, triptolide and triptonide, from the herb Tripterygium wilfordii Hook f. (TwHF), which possess anti-inflammatory activity, upregulate the expression of IL-37, and this expression was suppressed by ERK1/2 and p38 MAPK inhibitors. Overall, our research demonstrated, for the first time, that anti-inflammatory active components (triptolide and triptonide) upregulated the expression of IL-37 most likely via activation of the ERK1/2 and p38 MAPK pathways. Keywords: IL-37; THP-1 cells; Tripterygium wilfordii Hook F.; triptolide; triptonide IL-37 is a newly defined member of the IL-1 cytokine family, which is a fundamental inhibitor of innate immunity. 1 IL-37 mRNA and protein have been detected in inflammatory and autoimmune diseases such as rheumatoid arthritis, 1 atopic dermatitis, 2 inflammatory bowel disease 3 and systemic lupus erythematosus. 4 IL-37 is endogenously kept at low levels in human cells, and can be upregulated by pro-inflammatory cytokines and inflammation stimuli. 1 However, it is still unclear whether anti-inflammatory medications induce the expression of IL-37. We document here, for the first time, that IL-37 was upregulated in THP-1 cells induced by two active components, triptolide and triptonide, extracted from the herb Tripterygium wilfordii Hook F (TwHF).In this study, THP-1-derived macrophages were used as a model system. 5 THP-1 cells were treated with five active monomer components (triptolide, triptonide, triptophenolide, celastrol and wilforlide A (Beijing Medicass Biotechnol, Beijing, China)) with purity of more than 98% at different concentrations (1, 5, 10 and 20 ng/ml) for various incubation periods (1, 6, 12 and 18 h). The expression of IL-37 mRNA was analyzed by real-time quantitative PCR using SYBR Premix Ex Taq kit (TaKaRa, Dalian, China) on the ABI prism 7700 Sequence Detection System (Perkin Elmer, Foster City, CA, USA). The sequences of the primers were as follows: IL-37-F (TTAGAAGACCCGGCTGGAAGCC) and IL-37-R (AGATCT-CTGGGCGTATGTAGT); GAPDH-F (ACCCAGAAGACTGT-GGATGG) and GAPDH-R (TTCTAGACGGCAGGTCAGGT). The expression of the target gene is presented as a ratio, which was normalized to the endogenous reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the comparative CT method was used as reported in the literature. 6 The chemical structure of triptolide and triptonide are shown in Figure 1a. The results showed that triptolide and triptonide upregulated the expression of IL-37 mRNA (Figure 1b and c). As shown in Figure 1b, triptolide at concentrations of 5, 10 and 20 ng/ml was found to upregulate IL-37 mRNA, and the maximum upregu...

As a Chinese traditional patent medicine, Tripterygium wilfordii glycosides (TWG) have been approved by the China State Food and Drug Administration (Z32021007) for autoimmune and inflammatory diseases. Application of TWG leads to significant decrease of the inflammatory cytokines, such as IL-6, IL-1β, and TNF-α. However, little is known whether TWG could regulate the anti-inflammatory cytokines and what the mechanism is. Here, we found that TWG could induce the upregulation of IL-37 which is a new anti-inflammatory cytokine. Furthermore, the inhibitors of ERK1/2 and/or p38 MAPK pathways suppressed IL-37 expression induced by TWG, indicating that the two pathways took part in this process. In conclusion, TWG could upregulate the anti-inflammatory cytokine IL-37 and ERK1/2 and p38 MAPK signal pathways were involved in the upregulation of IL-37 induced by TWG. The results showed that TWG had a potent activity on promoting the expression of IL-37, a new anti-inflammatory cytokine, which help further understanding the anti-inflammatory mechanism for the clinical application of TWG in therapy of diseases.

No abstract