IL-37 is an anti-inflammatory cytokine that was only recently identified, and it is highly expressed in tissues from patients with inflammatory and autoimmune diseases. Inflammatory cytokines and inflammatory stimuli can induce the upregulation of IL-37. However, it has not been reported whether anti-inflammatory medications induce the expression of IL-37. In this work, we uncovered, for the first time, that two main bioactive components, triptolide and triptonide, from the herb Tripterygium wilfordii Hook f. (TwHF), which possess anti-inflammatory activity, upregulate the expression of IL-37, and this expression was suppressed by ERK1/2 and p38 MAPK inhibitors. Overall, our research demonstrated, for the first time, that anti-inflammatory active components (triptolide and triptonide) upregulated the expression of IL-37 most likely via activation of the ERK1/2 and p38 MAPK pathways. Keywords: IL-37; THP-1 cells; Tripterygium wilfordii Hook F.; triptolide; triptonide IL-37 is a newly defined member of the IL-1 cytokine family, which is a fundamental inhibitor of innate immunity. 1 IL-37 mRNA and protein have been detected in inflammatory and autoimmune diseases such as rheumatoid arthritis, 1 atopic dermatitis, 2 inflammatory bowel disease 3 and systemic lupus erythematosus. 4 IL-37 is endogenously kept at low levels in human cells, and can be upregulated by pro-inflammatory cytokines and inflammation stimuli. 1 However, it is still unclear whether anti-inflammatory medications induce the expression of IL-37. We document here, for the first time, that IL-37 was upregulated in THP-1 cells induced by two active components, triptolide and triptonide, extracted from the herb Tripterygium wilfordii Hook F (TwHF).In this study, THP-1-derived macrophages were used as a model system. 5 THP-1 cells were treated with five active monomer components (triptolide, triptonide, triptophenolide, celastrol and wilforlide A (Beijing Medicass Biotechnol, Beijing, China)) with purity of more than 98% at different concentrations (1, 5, 10 and 20 ng/ml) for various incubation periods (1, 6, 12 and 18 h). The expression of IL-37 mRNA was analyzed by real-time quantitative PCR using SYBR Premix Ex Taq kit (TaKaRa, Dalian, China) on the ABI prism 7700 Sequence Detection System (Perkin Elmer, Foster City, CA, USA). The sequences of the primers were as follows: IL-37-F (TTAGAAGACCCGGCTGGAAGCC) and IL-37-R (AGATCT-CTGGGCGTATGTAGT); GAPDH-F (ACCCAGAAGACTGT-GGATGG) and GAPDH-R (TTCTAGACGGCAGGTCAGGT). The expression of the target gene is presented as a ratio, which was normalized to the endogenous reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the comparative CT method was used as reported in the literature. 6 The chemical structure of triptolide and triptonide are shown in Figure 1a. The results showed that triptolide and triptonide upregulated the expression of IL-37 mRNA (Figure 1b and c). As shown in Figure 1b, triptolide at concentrations of 5, 10 and 20 ng/ml was found to upregulate IL-37 mRNA, and the maximum upregu...

as a novel anti-inflammatory cytokine of the interleukin (il)-1 family, il-37 protects the human body from diseases characterized by excessive inflammation. The pathologic process of hyperhomocysteinemia (hHcy) is accompanied by persistent inflammation. However, little is known regarding the role of IL-37 in hHcy. In the present study, the levels of cytokines including il-37, il-1β, il-6 and tumor necrosis factor-α in the supernatant were detected by ELISA. mRNA and protein expression were detected by Reverse transcription-quantitative PCR and western blotting, respectively. LDH level was determined by ELISA and the cell viability was detected through CCK-8 kit. In the present study, mean serum IL-37 levels of patients with hHcy were 32.3% lower than those of controls (P<0.01). In peripheral blood mononuclear cells (PBMCs) from patients with hHcy, mean IL-37 mRNA expression was 73.5% lower (P<0.01) and IL-37 protein expression was 77.7% lower compared with that of healthy controls (P<0.01). Furthermore, the results demonstrated that exogenous homocysteine (Hcy) stimulation markedly downregulated the mRNA and protein expression levels of il-37 in PBMcs in vitro. in 293T cells, overexpression of il-37 restored the cell viability impaired by Hcy, and reduced the release of lactate dehydrogenase and the proinflammatory cytokines IL-1β, il-6 and tumor necrosis factor-α. In conclusion, IL-37 was downregulated by Hcy in vivo and in vitro, and il-37 exhibited a protective role against cell injury induced by Hcy.