BackgroundAlmond witches’-broom (AlmWB), a devastating disease of almond, peach and nectarine in Lebanon, is associated with ‘Candidatus Phytoplasma phoenicium’. In the present study, we generated a draft genome sequence of ‘Ca. P. phoenicium’ strain SA213, representative of phytoplasma strain populations from different host plants, and determined the genetic diversity among phytoplasma strain populations by phylogenetic analyses of 16S rRNA, groEL, tufB and inmp gene sequences.ResultsSequence-based typing and phylogenetic analysis of the gene inmp, coding an integral membrane protein, distinguished AlmWB-associated phytoplasma strains originating from diverse host plants, whereas their 16S rRNA, tufB and groEL genes shared 100 % sequence identity. Moreover, dN/dS analysis indicated positive selection acting on inmp gene. Additionally, the analysis of ‘Ca. P. phoenicium’ draft genome revealed the presence of integral membrane proteins and effector-like proteins and potential candidates for interaction with hosts. One of the integral membrane proteins was predicted as BI-1, an inhibitor of apoptosis-promoting Bax factor. Bioinformatics analyses revealed the presence of putative BI-1 in draft and complete genomes of other ‘Ca. Phytoplasma’ species.ConclusionThe genetic diversity within ‘Ca. P. phoenicium’ strain populations in Lebanon suggested that AlmWB disease could be associated with phytoplasma strains derived from the adaptation of an original strain to diverse hosts. Moreover, the identification of a putative inhibitor of apoptosis-promoting Bax factor (BI-1) in ‘Ca. P. phoenicium’ draft genome and within genomes of other ‘Ca. Phytoplasma’ species suggested its potential role as a phytoplasma fitness-increasing factor by modification of the host-defense response.Electronic supplementary materialThe online version of this article (doi:10.1186/s12866-015-0487-4) contains supplementary material, which is available to authorized users.

No abstract

Candidatus Phytoplasma phoenicium' is associated with a lethal disease of almond, peach and nectarine named almond witches'-broom disease (AlmWB). The disease spread rapidly in Lebanon from coastal areas to elevations exceeding 1200 m, killing over 150,000 trees in a span of two decades. The mode of spread suggested the involvement of efficient vector(s) and Asymmetrasca decedens (Hemiptera, Cicadellidae) was suspected as it is the most abundant leafhopper species present in Lebanese stone fruit orchards. Living A. decedens specimens were collected from fields heavily infested by AlmWB and used in transmission trials on healthy peach almond hybrid GF-677 and peach GF-305 seedlings with an inoculation-access period of 30 days. PCR analysis supported by sequencing showed that A. decedens is a carrier of the phytoplasma, and that the phytoplasma was detected in insect salivary glands and in some inoculated GF-677 and GF-305 seedlings. One year post-inoculation, 'Ca. P. phoenicium' was detected in newly emergent leaves of inoculated seedlings. However, the characteristic symptoms of witches'-broom were not observed. PCR amplified fragments from phytoplasma-positive seedlings and from A. decedens samples showed 99.9% nucleotide identity in their 16S RNA region and phylogenetic analysis using a neighbour jointing tree confirmed that the phytoplasmas detected in both insects and inoculated seedlings belonged to 16SrIX-B (D). The present manuscript is the first known report for a leafhopper vector of 'Ca. P. phoenicium' and shows that the incubation period of the disease in plants may be longer than 1 year. The importance of phytosanitary control measures, the adoption of a national strategy and regional cooperation in order to contain the further spread of the disease are discussed.

During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5′AGCTGTATCTTGGGCAACAGA3′ and SqA2F: 5′TATCTCCCATCTTGGCAAGG3′; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production. References: (1) Antignus et al. Phytoparasitica 31:415, 2003. (2) Guenoune-Gelbart et al. J. Virol. Methods 168:87, 2010. (3) Rojas et al. Plant Dis. 77:340, 1993. (4) Zhang et al. J. Virol. Methods 71:45, 1998.

Almond witches'-broom (AlmWB) disease, associated with 'Candidatus Phytoplasma phoenicium', is an emerging threat with real risk of introduction in Euro-Mediterranean Countries. Its rapid spread over large geographical areas suggests the presence of efficient insect vector(s). In the present work, a survey on cixiids was carried out in Lebanon in the years 2010-2013 in AlmWB-infested almond and nectarine orchards. Insects were collected by means of different methods, identified with a stereo microscope, and analysed for phytoplasma identification through 16S rDNA PCR-based amplification and nucleotide sequence analyses. Preliminary transmission trials were performed with the most abundant species. A list of the cixiid genera and species present in the studied area is given as well as some information about their biology. 'Ca. Phytoplasma phoenicium' strains were detected in the genera Cixius, Tachycixius, Eumecurus and Hyalesthes. Preliminary trials revealed that Tachycixius specimens were able to transmit the detected strains to healthy peach potted seedlings. Further studies are required to better clarify the taxonomic status and the bio-ethology of collected planthoppers and deeply study their role as phytoplasma vectors.