The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying bla CTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying bla CTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group.CTX-M-type enzymes were reported in Germany and Argentina in 1989, and so far, more than 67 CTX-M-type ␤-lactamases have been identified, mostly in Escherichia coli, Klebsiella pneumoniae, and Salmonella enterica serovar Typhimurium isolates (http://www.lahey.org). The global spread is now a major concern in certain areas such as Latin America, Asia, Europe, Africa, and North America (5).Data on the prevalence and distribution of CTX-M-type enzymes are very limited in Turkey. Two studies revealed that CTX-M enzymes were present and disseminated among Enterobacteriaceae family isolates in Turkey (1, 10). The aim of this study was to determine the current prevalence of the CTX-M-1 group and the molecular characteristics in E. coli clinical isolates in a university hospital in Istanbul, Turkey.(This work was presented in part as a poster at the "Microbes in a Changing World" Congress of the International Union of Microbiological Societies (IUMS), San Francisco, CA, 23 to 28 July 2005.)A total of 1,010 consecutive nonrepetitive isolates of E. coli obtained from inpatients and outpatients at the hospital of Istanbul Faculty of Medicine over a 2-year period (2002 to 2004) were screened for extended-spectrum ␤-lactamase (ESBL) production, using the double-disc synergy test. A total of 61 E. coli isolates (27 from inpatients and 34 from outpatients) with ESBL phenotypes were included in this study, the majority of which were from the urine and respiratory specimens of patients treated in six different medical and surgical wards.MICs were determined by the agar dilution method. MICs for cefotaxime, ceftriaxone, and ceftazidime used alone and in combination were determined, with 4 g/ml clavulanic acid for phenotypic detection of ESBLs.Conjugation experiments for the transfer of cefotaxime resistance were carried out with all CTX-M-1-producing E. coli isolates (8). Crude extracts of ␤-lactamases were subjected to isoelectric focusing (IEF) (3).All isolates were screened for the CTX-M-1 group (13) and bla TEM (16) and bla SHV (9). Strains which had pI bands at 7.3 were subjected to bla OXA-1 -like PCR using the primers OXA-1-A (5Ј-GAATCGCATTATCACTTATGG-3Ј) and OXA-1-B (5Ј-GATACATGTTCTCTATGG-3Ј; this study). PCR amplicons for linking ISEcp1 with bla CTX-M were obtained by anchoring one primer at the 3Ј end of bla CTX-M (bla CTX-M reverse, 5ЈCACTTTGTCGTCTAAGGCG3Ј) and the other to the 5Ј end of ISEcp1 (5ЈAATACTACCTTGGCTTTCTGA3Ј).Sequencing was carried out with both strands by using the dideoxy chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using a Lasergene DNASTAR software package. Sequence alignments were done u...

Over a 9-month period, 14 strains of Ralstonia pickettii were isolated from various biological samples inoculated in a blood culture medium. Molecular epidemiological investigation confirmed the relatedness of the strains. The source of the contamination proved to be the blood culture bottle caps.Ralstonia pickettii (formerly Pseudomonas picketti and Burkholderia pickettii) is a nonfermenting gram-negative bacillus of relatively low virulence that is often associated with pseudobacteremia or asymptomatic colonization of patients. Contamination of water supplies, skin disinfectants, and saline solutions used either for patient care (1,2,3,5,7,8) or for laboratory diagnosis (4, 9) have previously been incriminated. We report on a new source of contamination caused by R. pickettii in biological samples of patients hospitalized in different units of Antoine Béclère Hospital, Clamart, France.Between March and November 2000, 14 strains of R. pickettii were isolated from various biological samples (five pleural fluid, three ascitic fluid, three pus, and two biopsy samples and one blood sample) inoculated in an enrichment broth (Vital system; BioMérieux, Marcy l'Etoile, France) generally used for blood culture. All samples except the blood sample were inoculated in the microbiology laboratory in both aerobic and anaerobic bottles by removing the caps to open the bottles, a procedure chosen to protect laboratory technicians from the risk of contamination through needle-stick injuries. Growth of R. pickettii was detected in 12 anaerobic bottles and 2 aerobic bottles after 48 to 72 h of incubation in the Vital system at 37°C. All strains were identified by use of the API NE identification system (BioMérieux). Antibiotic susceptibility patterns were determined by the disk diffusion method on MuellerHinton agar (Bio-Rad, Marnes-la-Coquette, France) and were interpreted according to the standards of the Comité de l'Antibiogramme de la Société Française de Microbiologie. The clonalities of the strains were established by random amplified polymorphic DNA (RAPD) analysis, as described previously (6), with primers P3 (5Ј-AGACGTCCAC-3Ј) and P15 (5Ј-AATGGCGCAG-3Ј) (Genset, Paris, France). Briefly, DNA extraction was performed with chloroform and isopropanol after cell lysis with lysozyme and proteinase K. The extracted DNA was amplified in a Trio-Thermoblock system (Biometra). The amplification products were then analyzed by electrophoresis in a 1.5% agarose gel, stained with ethidium bromide, and detected by UV transillumination. For pulsedfield gel electrophoresis (PFGE), DNA embedded in agarose plugs was digested with the SpeI restriction enzyme (4). Separation of the DNA fragments was carried out on a 1.2% agarose gel in a CHEF-DR III system (Bio-Rad). The separated fragments were stained with ethidium bromide and visualized by UV transillumination.An epidemiological investigation was undertaken to elucidate the source of contamination, since isolation of these strains did not correlate with the medical status of any of the sam...

This study shows that inoculation of S. aureus in 10(6) CFU/10 microl concentration at the decorticated lamina after implantation of a titanium screw in rat spine is a reproducible model for spinal infection and can be used for the animal model of prophylaxis and treatment and of postoperative infection.

Aims: To determine the prevalence of nasopharyngeal carriage of Streptococcus pneumoniae in healthy children aged 0-6 years who were vaccinated with pneumococcal conjugate vaccine.Methods: This cross-sectional study was conducted on 150 healthy Turkish children between 1 month and 6 years of age. Serotyping was performed and risk factors of carriage were evaluated.Results: The overall carriage rate was 14%. Vaccine type serotypes were determined in 17 (12.6%) children who received full-dose PCV13 vaccine. The highest carriage rate was observed among children younger than 24 months (76.2%). In multivariate analysis, respiratory infection in recent months, age, attendance at a day-care center and antibiotic usage were not statistically significant risk factors for carriage. Overall, S. pneumoniae strains were considered as penicillin susceptible and antimicrobial resistance was limited.Conclusion: We observed a low rate of pneumococcal carriage in children after PCV13 implementation compared with that of children receiving PCV7. Although it was reduced, vaccine serotype colonization in PCV13-vaccinated children remains persistent.

No abstract