No abstract

Resistance rates to amikacin, ciprofloxacin, ceftazidime, cefepime, imipenem, cefoperazone/sulbactam and piperacillin/tazobactam in Escherichia coli (n= 438), Klebsiella pneumoniae (n= 444), Pseudomonas aeruginosa (n= 210) and Acinetobacter baumanni (n=200) were determined with e-test in a multicenter surveillance study (Hitit-2) in 2007. ESBL production in Escherichia coli and K. pneumoniae was investigated following the CLSI guidelines. Overall 42.0% of E.coli and 41.4% of K. pneumoniae were ESBL producers. In E. coli , resistance to imipenem was not observed, resistance to ciprofloxacin and amikacin was 58.0% and 5.5% respectively. In K. pneumoniae resistance to imipenem, ciprofloxacin and amikacin was 3.1%, 17.8% 12.4% respectively. In P. aeruginosa the lowest rate of resistance was observed with piperacillin/tazobactam (18.1%). A. baumanni isolates were highly resistant to all the antimicrobial agents, the lowest level of resistance was observed against cefoperazone/sulbactam (52.0%) followed by imipenem (55.5%). this study showed that resistance rates to antimicrobials are high in nosocomial isolates and show variations among the centers.

The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying bla CTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying bla CTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group.CTX-M-type enzymes were reported in Germany and Argentina in 1989, and so far, more than 67 CTX-M-type ␤-lactamases have been identified, mostly in Escherichia coli, Klebsiella pneumoniae, and Salmonella enterica serovar Typhimurium isolates (http://www.lahey.org). The global spread is now a major concern in certain areas such as Latin America, Asia, Europe, Africa, and North America (5).Data on the prevalence and distribution of CTX-M-type enzymes are very limited in Turkey. Two studies revealed that CTX-M enzymes were present and disseminated among Enterobacteriaceae family isolates in Turkey (1, 10). The aim of this study was to determine the current prevalence of the CTX-M-1 group and the molecular characteristics in E. coli clinical isolates in a university hospital in Istanbul, Turkey.(This work was presented in part as a poster at the "Microbes in a Changing World" Congress of the International Union of Microbiological Societies (IUMS), San Francisco, CA, 23 to 28 July 2005.)A total of 1,010 consecutive nonrepetitive isolates of E. coli obtained from inpatients and outpatients at the hospital of Istanbul Faculty of Medicine over a 2-year period (2002 to 2004) were screened for extended-spectrum ␤-lactamase (ESBL) production, using the double-disc synergy test. A total of 61 E. coli isolates (27 from inpatients and 34 from outpatients) with ESBL phenotypes were included in this study, the majority of which were from the urine and respiratory specimens of patients treated in six different medical and surgical wards.MICs were determined by the agar dilution method. MICs for cefotaxime, ceftriaxone, and ceftazidime used alone and in combination were determined, with 4 g/ml clavulanic acid for phenotypic detection of ESBLs.Conjugation experiments for the transfer of cefotaxime resistance were carried out with all CTX-M-1-producing E. coli isolates (8). Crude extracts of ␤-lactamases were subjected to isoelectric focusing (IEF) (3).All isolates were screened for the CTX-M-1 group (13) and bla TEM (16) and bla SHV (9). Strains which had pI bands at 7.3 were subjected to bla OXA-1 -like PCR using the primers OXA-1-A (5Ј-GAATCGCATTATCACTTATGG-3Ј) and OXA-1-B (5Ј-GATACATGTTCTCTATGG-3Ј; this study). PCR amplicons for linking ISEcp1 with bla CTX-M were obtained by anchoring one primer at the 3Ј end of bla CTX-M (bla CTX-M reverse, 5ЈCACTTTGTCGTCTAAGGCG3Ј) and the other to the 5Ј end of ISEcp1 (5ЈAATACTACCTTGGCTTTCTGA3Ј).Sequencing was carried out with both strands by using the dideoxy chain termination method with a Perkin Elmer Biosystems 377 DNA sequencer. Sequence analysis was performed using a Lasergene DNASTAR software package. Sequence alignments were done u...

eThe antibacterial activity of fosfomycin-tobramycin combination was studied by time-kill assay in eight Pseudomonas aeruginosa clinical isolates belonging to the fosfomycin wild-type population (MIC ‫؍‬ 64 g/ml) but with different tobramycin susceptibilities (MIC range, 1 to 64 g/ml). The mutant prevention concentration (MPC) and mutant selection window (MSW) were determined in five of these strains (tobramycin MIC range, 1 to 64 g/ml) in aerobic and anaerobic conditions simulating environments that are present in biofilm-mediated infections. Fosfomycin-tobramycin was synergistic and bactericidal for the isolates with mutations in the mexZ repressor gene, with a tobramycin MIC of 4 g/ml. This effect was not observed in strains displaying tobramycin MICs of 1 to 2 g/ml due to the strong bactericidal effect of tobramycin alone. Fosfomycin presented higher MPC values (range, 2,048 to >2,048 g/ml) in aerobic and anaerobic conditions than did tobramycin (range, 16 to 256 g/ml). Interestingly, the association rendered narrow or even null MSWs in the two conditions. However, for isolates with high-level tobramycin resistance that harbored aminoglycoside nucleotidyltransferases, time-kill assays showed no synergy, with wide MSWs in the two environments. glpT gene mutations responsible for fosfomycin resistance in P. aeruginosa were determined in fosfomycin-susceptible wild-type strains and mutant derivatives recovered from MPC studies. All mutant derivatives had changes in the GlpT amino acid sequence, which resulted in a truncated permease responsible for fosfomycin resistance. These results suggest that fosfomycin-tobramycin can be an alternative for infections due to P. aeruginosa since it has demonstrated synergistic and bactericidal activity in susceptible isolates and those with low-level tobramycin resistance. It also prevents the emergence of resistant mutants in either aerobic or anaerobic environments.

In S. pneumoniae from Turkey, there has been a clear statistically significant reduction in susceptibility to key antibiotics since 2002, but not to amoxicillin/clavulanic acid (or amoxicillin). However, susceptibility in H. influenzae remained stable. Continued surveillance is required to monitor future changes in antibiotic susceptibility for CA-RTI bacteria.