Purpose: The antimicrobial activity of the 90 % ethanol extract of the aerial parts of Sida acuta Burm. F. (Malvaceae) was investigated in other to verify its claimed ethno medicinal use in the treatment of microbial infections. Method: The antimicrobial activity of the extract was tested against standard strains and clinical isolates of some aerobic bacteria and a fungus using the Agar well diffusion method. Commercial antibiotics were used as positive reference standards to determine the sensitivity of the strains. Results: The extracts showed significant inhibitory activity against standard strains and clinical isolates of Staphylococcus aureus, clinical isolates of Bacillus subtilis and Streptococcus faecalis. The MIC values obtained using the Agar-dilution test ranged from 5.0 mg/ml.-10.0 mg/ml. Neither the concentrated extract nor its dilutions inhibited Esherichia coli, Klebsiella pneumonia, Pseudomonas aeruginosa and Candida albicans Conclusion: The results demonstrate that the crude extract of the aerial parts of Sida acuta has a narrow spectrum of activity and suggest that it may be useful in the treatment of infections caused by Gram positive aerobic bacteria.

No abstract

While numerous studies examine the epidemiology and molecular characterization of Staphylococcus aureus in most developed countries, the detailed molecular characterization and molecular epidemiology of S. aureus strains and clones in Africa is lacking. We determined the molecular epidemiology and virulence of 81 non-duplicate isolates of S. aureus from Benin-City, Nigeria, collected during January–July 2016, and compared with global strains. Forty-seven isolates (58.0%) were found to be methicillin-sensitive Staphylococcus aureus (MSSA), while 34 (42.0%) were methicillin-resistant Staphylococcus aureus (MRSA). ST152-MSSA (24.7%) and ST7-MRSA-V (19.8%) were the dominant groups identified, which were not genetically related to global predominant strains, but rather exhibited regional dominance. An interesting finding of the study was the presence of highly related strains in the region, which differed primarily in their methicillin resistance gene carriage, staphylococcal cassette chromosome mec (SCCmec), with 99.4–99.7% relatedness between the genomes of the strains within the MRSA–MSSA pairs. This suggests that the strains within a pair are experiencing gain or loss of SCCmec within local conditions, with evolution continuing to diversify the strains to a small degree. This study represents the most comprehensive genetic and virulence study of S. aureus in Nigeria.

Umec-F GGCCACGCGTCGACTAGTACCCAGGTTCAACYCAAAAAATATTAAC mecA This study Umec-FX GGCCACGCGTCGACTAGTACTTGGAACGATGCCTATCTCATATGC Reversed mecA of SCCmec X This study Round 2 real-time PCR reaction 1 (orfX reaction) Arb3 TTACACCAGACTTGCACTCGG Right side tail of SA-3e This study SA-4 CACTTGTTCAATTAACACAACC orfX This study *SA-HEX-1 5 -/5HEX/CGGATCAAA/ZEN/CGGCCTGCACAAG/3IABkFQ/-3 orfX This study Round 2 real-time PCR reaction 2 (mecA reaction) Arb2 GGCCACGCGTCGACTAGTAC Left side tail of Umec-F/Umec-FX Caetano-Anolles, 1993 Umec-R ATGTTRTCTGATGATTCTATTGCTTG mecA This study Umec-RX GGAAGTTAGATTGGGATCATAGCG Reversed mecA of SCCmec X This study*mec-FAM-2 5 -/56-FAM/AGGGTTGGC/ZEN/AAAAAGATGCATCATGGG/3IABkFQ/-3 mecA This study *mec-FAM-3 5 -/56-FAM/AAGGTTGGC/ZEN/AAAAAGATAAATCTTGGG/3IABkFQ/-3 mecA This study *mec-FAM-4 5 -/56-FAM/CGTGGTAAA/ZEN/ATTTTAGACCGAAACAATGTG/3IABkFQ/-3 Reversed mecA of SCCmec X This study a Primers used in each reaction are listed, with their corresponding sequences and gene/sequence target. b The tail sequences were underlined. *Indicates probes.