Plant respiratory burst oxidase homologs (Rboh) are homologs of the human neutrophil pathogen-related gp91 phox . Antisense technology was employed to ascertain the biological function of Lycopersicon esculentum (tomato) Rboh. Lines with diminished Rboh activity showed a reduced level of reactive oxygen species (ROS) in the leaf, implying a role for Rboh in establishing the cellular redox milieu. Surprisingly, the antisense plants acquired a highly branched phenotype, switched from indeterminate to determinate growth habit, and had fasciated reproductive organs. Wound-induced systemic expression of proteinase inhibitor II was compromised in the antisense lines, indicating that ROS intermediates supplied by Rboh are required for this wound response. Extending these observations by transcriptome analysis revealed ectopic leaf expression of homeotic MADS box genes that are normally expressed only in reproductive organs. In addition, both Rbohdependent and -independent wound-induced gene induction was detected as well as transcript changes related to redox maintenance. The results provide novel insights into how the steady state cellular level of ROS is controlled and portrays the role of Rboh as a signal transducer of stress and developmental responses.

We identified the interaction sites of several miRNAs with the mRNAs from paralogs and orthologs of the SPL and HAM genes in A. thaliana. miRNAs from the miR156 and miR157 families in A. thaliana are shown to have binding sites within the mRNAs of SPL genes. The ath-miR156a–j binding sites located in the mRNAs of the SPL paralogs contain the sequence GUGCUCUCUCUCUUCUGUCA. This sequence encodes the ALSLLS motif. miR157a–d bind to mRNAs of the SPL family at the same site. We suggest merging the miR156 and miR157 families into one family. Several SPL genes in eight plants contain conserved miR156 binding sites. GUGCUCUCUCUCUUCUGUCA polynucleotide is homologous in its binding sites. The ALSLLS hexapeptide is also conserved in the SPL proteins from these plants. Binding sites for ath-miR171a–c and ath-miR170 in HAM1, HAM2, and HAM3 paralog mRNAs are located in the CDSs. The conserved miRNA binding sequence GAUAUUGGCGCGGCUCAAUCA encodes the ILARLN hexapeptide. Nucleotides within the HAM1, HAM2, and HAM3 miRNA binding sites are conserved in the mRNAs of 37 orthologs from 13 plants. The miR171- and miR170-binding sites within the ortholog mRNAs were conserved and encode the ILARLN motif. We suggest that the ath-miR170 and ath-miR171a–c families should be in one family.

The sites of miR396 binding to mRNA of genes encoding growth regulating transcription factors (GRF) were identified for Arabidopsis thaliana, Glycine max, Hordeum vulgare, Medicago truncatula, Oryza sativa, Sorghum bicolor, Solanum lycopersicum, Triticum aestivum, Vitis vinifera, and Zea mays. The free energy of interaction of miR396 with mRNA was calculated, and the schemes of nucleotide linking in the binding sites were determined. In mRNA of GRF genes of all studied plants, miR396 binding sites were located in the protein coding part and encoded oligopeptides RSRKPVE or RSRKHVE. The regulation of the expression of plant GRF genes by miR396 family is discussed.Abbreviations: GRF-growth regulating transcription factors; miRNA-micro RNA; ΔG-free energy of miRNA binding; ΔG m -free energy for binding of miRNA to its completely com plementary nucleotide sequence; ΔG/ΔG m -relative value of the free energy.

No abstract

No abstract