EMT (epithelial-mesenchymal transition) occurs in a wide range of tumor types, and has been shown to be crucial for metastasis. Epigenetic modifications of histones contribute to chromatin structure and result in the alterations in gene expression. Tri-methylation of histone H3 lysine 4 (H3K4me3) is associated with the promoters of actively transcribed genes and can serve as a transcriptional on/off switch. RbBP5 is a component of the COMPASS/ -like complex, which catalyzes H3K4me3 formation. In this study, we found that in the process of TGF-Beta1 induced EMT in the prostate cancer cell line DU145, H3K4me3 enrichment and RbBP5 binding increased in the vicinity of Snail (SNAI1) transcription start site. Knocking-down of RbBP5 notably decreased Snail expression and EMT. Recruitment of RbBP5 and formation of H3K4me3 at Snail TSS during EMT depend on binding of SMAD2/3 and CBP at Snail TSS. This study links the SMAD2/3 signal with Snail transcription via a histone modification - H3K4me3. Furthermore, our research also demonstrates that RbBP5 and even WRAD may be a promising therapeutic candidates in treating prostate cancer metastasis, and that DU145 cells maintain their incomplete mesenchymal state in an auto/paracrine manner.

BackgroundSynpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family.MethodsWe used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines.ResultsOur results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family.ConclusionBased on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

Background Dysregulation of long noncoding RNA (lncRNA) expression is related to aging and age-associated neurodegenerative diseases, and the lncRNA expression profile in the aging hippocampus is not well characterized. In the present investigation, the changed mRNAs and lncRNAs were confirmed via deep RNA sequencing. GO and KEGG pathway analyses were conducted to investigate the principal roles of the clearly dysregulated mRNAs and lncRNAs. Subsequently, through the prediction of miRNAs via which mRNAs and lncRNAs bind together, a competitive endogenous RNA network was constructed. Results A total of 447 lncRNAs and 182 mRNAs were upregulated, and 385 lncRNAs and 144 mRNAs were downregulated. Real-time reverse transcription-polymerase chain reaction validated the reliability of mRNA and lncRNA sequencing. KEGG pathway and GO analyses revealed that differentially expressed (DE) mRNAs were associated with cell adhesion molecules (CAMs), the p53 signaling pathway (SP), phagosomes, PPAR SP and ECM—receptor interactions. KEGG pathway and GO analyses showed that the target genes of the DE lncRNAs were related to cellular senescence, the p53 signaling pathway, leukocyte transendothelial migration and tyrosine metabolism. Coexpression analyses showed that 561 DE lncRNAs were associated with DE mRNAs. A total of 58 lncRNA–miRNA–mRNA target pairs were confirmed in this lncRNA‒miRNA‒mRNA network, comprising 10 mRNAs, 13 miRNAs and 38 lncRNAs. Conclusions We found specific lncRNAs and mRNAs in the hippocampus of natural aging model rats, as well as abnormal regulatory ceRNA networks. Our outcomes help explain the pathogenesis of brain aging and provide direction for further research.

Oculocutaneous albinism (OCA) is a genetically heterogeneous disease and is most inherited in an autosomal recessive manner. The characteristic manifestation of OCA is due to disfunction of melanin synthesis. OCA1 is the most severe subtype of OCA and is caused by homozygous or compound heterozygous variants in tyrosinase (TYR) gene, which is the key gene for melanin synthesis. This study aimed to identify the genetic variants of a northern Chinese family with OCA1. Clinical information and peripheral blood samples were collected. PCR amplification and Sanger sequencing were used to detect the entire exons and adjacent flanking sequences of TYR gene. Functional prediction of variants was performed by various bioinformatic analyses, while the pathogenicity classification of variants was evaluated according to ACMG standards and guidelines. A missense variant NM_000372.5:c.107G > C;NP_000363.1:p.C36S was discovered in TYR gene which converted cysteine to serine. Another variant in intron, NM_000372.5:c.1037–7 T > A, also affected the function of TYR gene. We verified the pathogenicity of the intron variant with a pCAS2 mini‐gene based splicing assay and found that c.1037–7 T > A led to an insertion of 5 bp upstream from the common acceptor site of exon 3, which caused a frameshift TYR:c.1037–7 T > A:p.G346Efs*11. The results showed that the compound heterozygous variants c.107G > C:p.C36S and c.1037–7 T > A:p.G346Efs*11 of TYR gene were the pathogenic variants for this OCA1 family.

No abstract