Yellow leaf disease (YLD) with phytoplasmal aetiology is a serious disease of arecanut palm in India. The present study was undertaken to characterize the 16S rRNA and secA gene sequences of the Indian arecanut YLD phytoplasma for 'Candidatus Phytoplasma' species assignment and 16Sr group/subgroup classification. Phytoplasma 16S rRNA genes were amplified using three sets of semi-nested/nested primers, 1F7/7R3-1F7/7R2, 4Fwd/3Rev-4Fwd/5Rev and P1/P7-R16F2n/R16R2, producing amplicons of 491, 1150 and 1250 bp, respectively, from diseased samples. The amplicons were cloned and sequenced. A BLAST search showed that the sequences had 99 % similarity with sugar cane white leaf phytoplasma (16SrXI) and Napier grass stunt phytoplasma (16SrXI). Phylogenetic analysis based on the 16S rRNA gene revealed the clustering of YLD phytoplasma with the rice yellow dwarf and Bermuda grass white leaf groups. The YLD phytoplasma F2nR2 sequence shared 97.5 % identity with that of 'Candidatus Phytoplasma oryzae' and 97.8 % identity with that of 'Candidatus Phytoplasma cynodontis'. Hence, for finer differentiation, we examined the secA gene-based phylogeny, where the YLD phytoplasma clustered with Napier grass stunt and sugar cane grassy shoot phytoplasmas, both belonging to the rice yellow dwarf group. Hence, we are assigning the Indian arecanut YLD phytoplasma as a 'Candidatus Phytoplasma oryzae'-related strain. Virtual RFLP analysis of a 1.2 kb fragment of the 16S rRNA gene (F2nR2 region) identified the Indian arecanut YLD phytoplasma as a member of 16SrXI-B subgroup. We name the phytoplasma Indian yellow leaf disease phytoplasma, to differentiate it from the Hainan YLD phytoplasma, which belongs to group 16SrI.

Coconut palm (Cocos nucifera L.), a versatile tree crop with multifarious uses, is important for the livelihood security of millions of people in India. Root (wilt) disease (RWD) is a major production constraint causing an estimated yield loss of 968 million nuts in southern India. Affected palms show bending of leaflets (flaccidity), foliar yellowing, and marginal necrosis. Phytoplasmas have been observed to be associated with this disease by electron microscopy (EM) and transmission (3) but not characterized. Attempts made in the past decade to detect a phytoplasma associated with RWD through PCR using universal primers had inconsistent results so we designed two primer sets (1F7 [AGTGCTTAACACTGTCCTGCTA]/7R3 [TTGTAGCCCAGATCATAAGGGGCA], 3Fwd [ACCTGCCTTTAAGACGAGGA]/3Rev [AAAGGAGGTGATCCATCCCCACCT]) and seminested primer pair 1F7/7R2 (GACAAGGGTTGCGCTCGTTTT), 3Fwd/5Rev (ACCCCGAGAACGTATTCACCGCGA) from sequencing of a 1.8-kb fragment (GenBank No. FJ794816) amplified by primers P1/P7 from a diseased sample. These new primer pairs were used for the detection of phytoplasma from five symptomatic and five asymptomatic palms from Kasaragod (where disease is not endemic), 14 symptomatic palms from Kayamkulam (endemic area), and 10 palms from disease-free areas (Kidu, Karnataka) using PCR. DNA was extracted from 3 g of spindle leaf (two to three leaflets) midrib tissues using a modified phytoplasma enrichment protocol in which an addition of 5% polyvinylpolypyrrolidone (MW of 40,000) during tissue grinding was essential. PCR was performed for 35 cycles with an annealing temperature of 63°C to avoid nonspecific amplification. A 1.3-kb amplicon was seen in two of the five samples and the positive control sample (sugarcane grassy shoot DNA) using the seminested primer pair 3Fwd/3Rev–3Fwd/5Rev. The amplicons were cloned and sequenced and a representative sequence was deposited in GenBank (GQ850122). With the 1F7/7R3-1F7/7R2 seminested primers, a 493-bp product was obtained from 13 of 14 palms from Kayamkulam and all five diseased palms from Kasaragod. No amplification was seen from healthy palms. A BLAST search showed that the RWD phytoplasma 16S rRNA gene sequence has >96% nt identity with 16SrXI and 16SrXIV group phytoplasmas and 99% identity with sugarcane white leaf phytoplasma (AB052874), On the basis of the identity of the 16Sr RNA gene 3Fwd/5Rev region, RWD phytoplasma belongs to the 16SrXI group. A phylogenetic tree (neighbor-joining method) also revealed clustering of the coconut phytoplasma with the 16SrXI group phytoplasmas and virtual restriction fragment length polymorphism analysis (4) also placed it into group 16SrXI. Other phytoplasmas infecting coconut are found in groups 16SrIV (1) and 16SrXIV (2). Our RWD phytoplasma sequence does not match an earlier reported Kerala (wilt) coconut phytoplasma sequence (AY158660) and the latter sequence does not have similarity with any known phytoplasma sequences in the database. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the root wilt disease of coconut in India. These findings could be used for the early detection of root wilt disease phytoplasma in breeding materials and to develop a DNA-based diagnostic kit. References: (1) N. A. Harrison et al. Ann. Appl. Biol. 153:85, 2008. (2) N. Nejat et al. Am. J. Appl. Sci. 6:1331, 2009. (3) M. Sasikala et al. Eur. J. Plant Pathol. 94:191, 2005. (4) Y. Zhao et al. Int. J. Syst. Evol. Microbiol. 59:2582, 2007.

The arecanut palm (Areca catechu L.), Arecaceae family, is one of the most important commercial crops in the world, which yields fruits called arecanut that are used as a medicine and chewing substance (1). Yellow leaf disease (YLD) is one of the most serious diseases in areca palms in India. It reduces the yield as much as 50% over a period of 3 years immediately following disease incidence. Foliar yellowing, the most conspicuous symptom, begins from the inner whorl and spreads to the outer parts of the crown. Chlorosis is observed on almost all leaves in the whorl from edges of the leaflet to the midrib region. Stems become spongy and friable and the conducting strands are destroyed. Microscopic detection is evidence of the association of phytoplasma in YLD-affected areca palms (3). There is no evidence for molecular level detection of phytoplasma in YLD-affected palms. To prove the phytoplasma association in YLD-affected palms in India, samples (inflorescence, spindle leaf, mature leaf, and root) were collected from 15 (5 severe, 5 middle, and 5 early stage of the disease) YLD-affected areca palms and two symptomless palms at Sullia District, Karnataka. DNA was extracted from rachis of inflorescence, midrib of spindle leaf, and meristem of root samples as previously described (2). With universal primers there was no consistency in amplification. Then we used two sets of seminested primers, 1F7/7R3–1F7/7R2 and 4Fwd/3Rev–4Fwd/5Rev, which were designed to amplify the coconut root (wilt) disease (RWD) phytoplasma (2). With the seminested primers, 1F7/7R3–1F7/7R2, a 493-bp amplicon was obtained from 15 of 15 palms. With the seminested primers, 4Fwd/3Rev-4Fwd/5Rev, a 1.3-kb amplicon was seen in 11 samples and the positive control sample (sugarcane grassy shoot DNA). The amplicons were cloned and sequenced and two representative sequences were deposited in GenBank (GU552782 and HM215624). A BLAST search showed that the sequence has 99% nt identity with sugarcane white leaf phytoplasma (FM208260, 16sr XI), coconut RWD phytoplasma (GQ850122, 16sr XI), 98% nt identity with bermuda grass white leaf phytoplasma (AJ550986, 16sr XIV), and only 91% nt identity with YLD-affected areca phytoplasma reported from China (FJ998269 and FJ694685). The phylogenetic analysis revealed the clustering of YLD phytoplasma with 16s rRNA XI and 16s rRNA XIV groups. However, the YLD phytoplasma is closely related to the 16s rRNA XI group. PhytoDB–group identifier tool (http://220.227.88.253/phytodb) showed YLD phytoplasma from India belongs to the 16sr XI group. Earlier we reported the association of 16sr XI group phytoplasma with coconut RWD in India (2) and the YLD phytoplasma reported here has 99% nt identity with RWD phytoplasma. In southern India, coconut and arecanut are grown together in adjacent fields and there is a possible occurrence of the same phytoplasma in two different hosts. The current study proved the association of phytoplasma through nested PCR in YLD-affected areca palms in India and it is clustered with 16sr RNA XI group. Purushothama et al. (4) couldn't detect the phytoplasma with YLD-affected areca palms. To our knowledge, this is first report of the association of 16SrXI group phytoplasma with the arecanut YLD in India. References: (1) M. Hattori et al. Pharm. Soc. Wakan-yaku 10:141, 1993. (2) R. Manimekalai et al. Plant Dis. 94:636, 2010. (3) R. Nayar and C. E. Selsikar. Eur. J. For. Pathol. 8:125, 1978. (4) C. R. D. Purushothama et al. Bull. Insectol. 60:161, 2007. ERRATUM: On 27 October 2010, at the request of the authors, the title of this note was changed.

No abstract

No abstract