SUMMARYA eukaryotic plasmid DNA carrying the AACGTT CpG motif in its ampR gene is a 'danger' signal for mice and caused an increase in the specific antibody titres of fish and mice after immunization with b-galactosidase (b-gal ). A second pUC-based plasmid, which is inactive in mice and contains the GACGTC CpG motif in its cytomegalovirus (CMV ) promoter, had no effect on antibody responses to b-gal in either fish or mice. A synthetic oligonucleotide, which contains the GACGTT motif, potentiated antibody responses to co-administered b-gal protein in mice, but not in fish. This is early evidence that lower and higher vertebrates recognize different unmethylated CpG motifs as 'danger' signals. In addition, plasmid DNA expressing mouse granulocyte-macrophage colony-stimulating factor (GM-CSF ) had a marked effect on cytotoxic T-cell-like activity in fish by reducing the average number of myofibres that expressed b-gal, 28 days after co-injection with plasmid DNA expressing b-gal. Although the mechanism by which the mouse GM-CSF exerted its biological effects in fish is unknown, this finding might have important implications for fish vaccination, particularly when cytotoxic T cells may play a critical role.Plasmid DNAs encoding protective antigens of pathogens their increased responsiveness to immunostimulatory CpG. have shown promise as vaccines for the control of infectiousTo test this, a synthetic oligodeoxynucleotide (ODN ) diseases. Plasmid DNA, apart from encoding the antigen, has TCCATGACGTTCCTGACGTT (termed 1826) that increases pronounced immunostimulatory properties (adjuvant activity) murine antibody responses to proteins,8 was compared with that have been attributed to specific single-stranded oligonuclean ODN in which the two CG in 1826 were changed to GG otide sequences containing unmethylated CpG motifs.1 These (termed GpG ODN ), for their adjuvanticity to co-injected CpG motifs have been shown to exert a mitogenic effect on B b-gal protein in goldfish and mice. A second CpG system, in cells,2 and directly activate monocytes, macrophages, and which the entire pUC-based plasmid containing the CpGdendritic cells leading to secretion of cytokines that favour the ampR gene9 was compared with another pUC-based plasmid development of murine T helper 1 (Th1) effector cells.3,4 DNA containing the non-CpG-kanR gene9 in fish. from bacteria, insects and nematodes is immunostimulatory, Immune responses to DNA vaccines can be modulated by whereas DNA from mammals and lower vertebrates, e.g. fish coinjecting plasmid DNA expressing various cytokines that is not.5 Thus, bacterial DNA, but not eukaryotic DNA, play a critical regulatory role in immunity. GM-CSF in prompts the vertebrate innate immune system to sense 'danger' particular has been found to exert an adjuvant effect for by employing pattern recognition receptors with broad reactivantibody and cellular responses to DNA vaccines.10 In ity,6 as opposed to the antigen-specific receptors used by the addition, a cytokine akin to GM-CSF has been described in adapt...

No abstract

SUMMARYTwo mouse populations, randombred albino mice and a cross of four inbred strains, were divergently selected for high (H8) and low (L8) 8-week body weight over 18 generations using within-family and individual selection. The crossbreds showed asymmetry of selection response and realized heritabilities (H8 0·29 ± 0·01; L8 0·17 ± 0·01). In the randombred population realized heritabilities were symmetrical (H8 0·23 ± 0·01; L8 0·22 ± 0·02). Over the first nine generations individual selection was nearly 40 per cent better than within-family selection, as was expected from the full sib correlation in both populations. As selection progressed, within-family selection reached 82% and 61% of the responses obtained with individual selection in the crossbreds and randombred respectively. Correlated responses for 3-week (weaning) and 5-week body weights agreed with observations made on direct responses, but selection for L8 did not reduce weaning weight. Selection for L8 decreased and selection for H8 increased first litter size at birth. However, mass-selected L8-pairs had a higher life-reproduction and life-span than H8-pairs.

No abstract