The effects of chondroitin sulfate-C (CAS 25322-46-7, Chondroitin ZS Tab) on type II collagen (CII)-induced arthritis (CIA) in mice were evaluated. DBA/1J mice were immunized with bovine CII emulsified in Freund's complete adjuvant, followed by a booster injection 21 days later. Chondroitin sulfate-C at doses of 100, 300 and 1000 mg/kg was administered orally once daily beginning 14 days before initial immunization. An arthritis index and hind paw edema were examined from day 0 to day 49, when the mice were killed by ether anesthesia for histopathological examination. The delayed-type hypersensitivity (DTH) reaction, serum anti-CII antibody titer, and histopathologic characteristics of both synovitis and destruction of articular cartilage were analyzed. Both the arthritis index and the serum anti-CII antibody titer were reduced by treatment with chondroitin sulfate-C in a dose-dependent manner. Chondroitin sulfate-C (1000 mg/kg) significantly inhibited hind paw edema, synovitis and destruction of the articular cartilage, but not DTH reaction.

We examined the bone turnover and bone mass in adjuvant-induced arthritis in rats and assessed the effects of indomethacin in this model. One hundred ten SD rats, 6 weeks of age, were assigned to 11 groups and injected with adjuvant or solvent in the right foot. Adjuvant-injected rats were orally administered indomethacin at doses of 0 (vehicle), 0.1 (low), 0.5 (medium), and 1.5 (high) mg/kg body weight from the start (day 0). Animals were sacrificed on days 0, 14 (acute phase), and 28 (chronic phase). In the arthritic-control group, serum osteocalcin level and bone mineral content of the fourth lumbar body (L4) and the femur were significantly reduced on day 14. Serum alkaline-phosphatase was increased on day 28. Trabecular bone volume of L4 was decreased on day 14, and the value was further decreased on day 28. Bone formation rate (BFR/BS) was significantly reduced on day 14, and then osteoclast number (Oc.N/BS) increased on day 28. Indomethacin treatment dose-dependently prevented increases in paw volume and osteoclast number. In the high dose group, these indices were maintained at the same level with those in the normal group. However, indomethacin treatments were not able to maintain the parameters of bone formation such as serum osteocalcin and BFR/BS values, and the trabecular bone mass decrease was only partially prevented. These data clearly indicated both reduced bone formation and increased bone resorption as the causes of bone loss in adjuvant-induced arthritis in rats. Increased bone resorption seemed to be due to the increased activity of prostaglandins, but bone formation defect would be related to other factors in this animal model.

/nu؊ ) mice, the increase in TNF-a a and IFN-g g mRNA expression was found to be closely related to a reduction in LECT2 mRNA expression. These results suggest that the reduction in expression of LECT2 mRNA is not directly involved in apoptosis and may be inversely related to the expression of TNF-a a and/or IFN-g g mRNA in the injured liver.Key words leukocyte-derived chemotaxin 2; Con A-induced hepatic injury; apoptosis; LECT2; TNF-a and IFN-g mRNA bent assay (ELISA), as described previously.10) Briefly, excised liver was homogenized in a lysis buffer, allowed to stand at room temperature for 30 min, and then centrifuged at 700ϫg for 10 min. Twenty microliters of supernatant (equivalent to 170 mg wet weight liver tissue) was used for colorimetric measurement (450 nm) of DNA fragmentation using a cell death detection ELISA PLUS kit (Boehringer Mannheim, Mannheim, Germany).Western Blotting Analysis Sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) of mouse LECT2 protein in serum was performed as described by Laemmli using 14% gels.11) Proteins were blotted onto a PVDF filter (Millipore Japan, Tokyo, Japan). Purified polyclonal antibodies diluted to 0.2 mg/ml with phosphatebuffered saline (PBS) containing 3% skimmed milk were laid onto the filter. The filter was incubated for 60 min at room temperature and then washed three times with washing buffer containing 0.1% Tween 20 in PBS. Horseradish peroxidaseprotein G was then placed on the filter and allowed to stand for 60 min at room temperature. The filter was washed three times with washing buffer and positive bands were detected with an ECL detection kit (Amersham Pharmacia, Biotech AB, Uppsala, Sweden).RNA Isolation and Probe Labeling Total RNA was prepared from mouse liver using Isogen (NipponGene, Toyama, Japan), and 1 mg of RNA was reverse transcribed using avian myeloblastosis virus reverse transcriptase (Takara Shuzo, Kyoto, Japan) in a reaction volume of 20 ml containing oligodT-adaptor primers.12) Polymerase chain reaction (PCR) amplification was performed with GeneAmp 9700 (Perkin-Elmer Foster, CA, U.S.A.), in a reaction volume of 50 ml containing 1 ml of DNA solution. The mouse LECT2 and glyceraldehyde-3-phosphate dehydrogenase (G3PDH) primers were as follows: LECT2: TCCTCGAGATGATTCC-CACAACAATC and TGCTCGAGTAGGTATGCTGTGG; G3PDH: TGAAGGTCGGTGAACGGATTTGGC and CAT-GTAGGCCATGAGGTCCACCAC. LECT2 and G3PDH cDNA probes were prepared by second PCR amplification using digoxigenin-11-dUTP (Roche Diagnostics, Mannheim, Germany).Northern Blotting Analysis RNA samples (20 mg/lane) were subjected to electrophoresis in a 1% agarose gel containing 2.2 M formaldehyde, and then transferred to nylon membranes. The membranes were prehybridized and hybridized with digoxigenin-11-dUTP-labeled cDNA probes.TNF-a a, IFN-g g and LECT2 mRNA Expression in Liver Total liver RNA was amplified by reverse transcriptase-PCR (RT-PCR), electrophoresed on a 2.0% agarose gel and TNFa, IFN-g and LECT2 mRNA expression was then examined. In the RT-PCR, TCCTCGAGATGATTCCCACAAC...

No abstract

The inhibitory effect of β-alanyl-L-histidinato zinc (AHZ) on bone resorption in tissue culture was investigated. Calvaria were removed from weanling rats (3-week-old male) and cultured for periods up to 48 h in Dulbecco’s modified Eagle medium (high glucose, 4.5%) supplemented with antibiotics and bovine serum albumin. The experimental cultures contained 10^–7 to 10^–4 mol/l AHZ. The bone-resorbing factors, parathyroid hormone (1–34) (PTH; 10^–7 mol/l), prostaglandin E₂ (10^–5 mol/l), interleukin-1α (IL1α; 50 U/ml), and lipopoly-sacharide (10 μg/ml), caused a significant decrease in bone calcium content. The decreases in bone calcium content induced by bone-resorbing factors were completely inhibited by the coexistence of AHZ (10^–6 to 10^–4 mol/l). Also, AHZ (10^–5 mol/l) completely inhibited the PTH (10^–7 mol/l) or IL1α (50 U/ml)-induced increase in medium glucose consumption and lactic acid production by bone tissue. Furthermore, AHZ (10^–5 mol/l) fairly blocked both PTH (10^–7 mol/l)-increased acid phosphatase and decreased alkaline phosphatase activities of bone tissue. The inhibitory effect of AHZ (10^–5 mol/l) on PTH (10^–7 mol/l)-stimulated bone resorption was clearly prevented by the presence of 10^–4 mol/l dipicolinate, a chelator of zinc. However, zinc sulfate (10^–7 to 10^–4 mol/l) did not inhibit the PTH (10^–7 mol/l)-stimulated bone resorption in tissue culture. These findings indicate that AHZ had a direct inhibitory effect on bone resorption in vitro, and the AHZ effect was found in the chemical form of zinc-chelated dipeptide.