Objectives: The most recently discovered cytokine interleukin 37 (IL-37) received growing attention. Its function on tumor is largely unknown. Here, we investigated the biological function of IL-37 on cervical cancer (CC).Materials and methods: HPV+ Hela cells and HPV- C33A cells were used. RT-qPCR was performed to detect the transcription of IL-37, STAT3, TNF-αand IL-1β. Western blotting was used for protein detection. CCK-8 assay and transwell assay were employed for cell proliferation and invasion detection, respectively.Results: Successful gene transfection of IL-37 suppressed the proliferation and invasion of CC. Interestingly, IL-37 showed higher anticancer ability in HPV+ Hela cells than that in HPV- C33A cells. Then, the molecular mechanism of IL-37 anticancer was explored. Firstly, we found that IL-37 inhibited STAT3 expression at both mRNA and protein levels. IL-37 also down regulated the phosphorylation of STAT3. Secondly, blockage of STAT3 using siRNAs reduced significantly the ability of IL-37 to suppress cell proliferation and invasion. Thirdly, STAT3 knockdown reduced markedly the inhibition of IL-37 on the transcription of tumor-derived TNF-α and IL-1β, indicating the contribution of STAT3 for the cancer associated antiinflammation of IL-37. Finally, STAT3 up regulation restored the ability of cell proliferation, cell invasion and the expression of inflammatory cytokines, TNF-α and IL-1β.Conclusions: IL-37 suppressed cell proliferation and invasion of CC and STAT3 is involved in this process. Thus, IL-37 emerges as a new anticancer cytokine for CC. This study demonstrated a new biological function of IL-37 and offered a potential molecule for CC treatment.

Background: As master regulator of embryonic morphogenesis, homeodomain-containing gene 10 (HOXC10) has been found to promote progression of human cancers and indicates poor survival outcome. However, the role of HOXC10 in lung adenocarcinoma still unclear.Methods: HOXC10 expression was evaluated in 63 primary lung adenocarcinoma tissues from our local hospital, and further systematically confirmed in lung cancer tissues from six GEO datasets (GSE19188, GSE31210, GSE10072, GSE7670, GSE32863, GSE30219), and Kaplan-Meier plotter database. The role of HOXC10 in lung cancer metastasis was further validated by cellular and molecular studies.Results: The expression of HOXC10 was significantly increased in human lung adenocarcinoma samples from Wuhu No.2 People's Hospital, about 4.219 times compared with normal tissues, and significantly correlated with TNM stage, lymph node, and distal metastasis. Upregulation of HOXC10 indicated a poor overall/relapse free survival of lung cancer patients from Wuhu No.2 People's Hospital, GEO datasets, and Kaplan-Meier plotter database, especially in patients with lung adenocarcinoma. Knockdown or ectopic expression assays confirmed that HOXC10 enhanced the phosphorylation of PI3K, regulated the expression of epithelial-to-mesenchymal transition (EMT) markers: MMP2/9, VCAM-1, vimentin and E-cadherin. Cellular study further confirmed that HOXC10 was required for migration, invasion and adhesion of lung cancer cells.Conclusion: These findings suggest that HOXC10 plays a pivotal role in the metastasis of human lung cancer and highlight its usefulness as a potential prognostic marker or therapeutic target in human lung adenocarcinoma.

TPD (tapping panel dryness) is a complex physiological syndrome widely found in rubber tree (Hevea brasiliensis) plantations, which causes severe yield and crop losses in natural rubber-producing countries. The molecular mechanism underlying TPD is not known and there is presently no effective prevention or treatment for this serious disease. To investigate the molecular mechanism of TPD, we isolated and characterized genes for which the change of expression is associated with TPD. We report here the identification and characterization of a Myb transcription factor HbMyb1. HbMyb1 is expressed in leaves, barks, and latex of rubber trees, but its expression is significantly decreased in barks of TPD trees. Our results suggest that the expression of HbMyb1 is likely associated with TPD and that the function of HbMyb1 is associated with the integrity of bark tissue of rubber trees.

IL-37 is an anti-inflammatory cytokine that was only recently identified, and it is highly expressed in tissues from patients with inflammatory and autoimmune diseases. Inflammatory cytokines and inflammatory stimuli can induce the upregulation of IL-37. However, it has not been reported whether anti-inflammatory medications induce the expression of IL-37. In this work, we uncovered, for the first time, that two main bioactive components, triptolide and triptonide, from the herb Tripterygium wilfordii Hook f. (TwHF), which possess anti-inflammatory activity, upregulate the expression of IL-37, and this expression was suppressed by ERK1/2 and p38 MAPK inhibitors. Overall, our research demonstrated, for the first time, that anti-inflammatory active components (triptolide and triptonide) upregulated the expression of IL-37 most likely via activation of the ERK1/2 and p38 MAPK pathways. Keywords: IL-37; THP-1 cells; Tripterygium wilfordii Hook F.; triptolide; triptonide IL-37 is a newly defined member of the IL-1 cytokine family, which is a fundamental inhibitor of innate immunity. 1 IL-37 mRNA and protein have been detected in inflammatory and autoimmune diseases such as rheumatoid arthritis, 1 atopic dermatitis, 2 inflammatory bowel disease 3 and systemic lupus erythematosus. 4 IL-37 is endogenously kept at low levels in human cells, and can be upregulated by pro-inflammatory cytokines and inflammation stimuli. 1 However, it is still unclear whether anti-inflammatory medications induce the expression of IL-37. We document here, for the first time, that IL-37 was upregulated in THP-1 cells induced by two active components, triptolide and triptonide, extracted from the herb Tripterygium wilfordii Hook F (TwHF).In this study, THP-1-derived macrophages were used as a model system. 5 THP-1 cells were treated with five active monomer components (triptolide, triptonide, triptophenolide, celastrol and wilforlide A (Beijing Medicass Biotechnol, Beijing, China)) with purity of more than 98% at different concentrations (1, 5, 10 and 20 ng/ml) for various incubation periods (1, 6, 12 and 18 h). The expression of IL-37 mRNA was analyzed by real-time quantitative PCR using SYBR Premix Ex Taq kit (TaKaRa, Dalian, China) on the ABI prism 7700 Sequence Detection System (Perkin Elmer, Foster City, CA, USA). The sequences of the primers were as follows: IL-37-F (TTAGAAGACCCGGCTGGAAGCC) and IL-37-R (AGATCT-CTGGGCGTATGTAGT); GAPDH-F (ACCCAGAAGACTGT-GGATGG) and GAPDH-R (TTCTAGACGGCAGGTCAGGT). The expression of the target gene is presented as a ratio, which was normalized to the endogenous reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the comparative CT method was used as reported in the literature. 6 The chemical structure of triptolide and triptonide are shown in Figure 1a. The results showed that triptolide and triptonide upregulated the expression of IL-37 mRNA (Figure 1b and c). As shown in Figure 1b, triptolide at concentrations of 5, 10 and 20 ng/ml was found to upregulate IL-37 mRNA, and the maximum upregu...