A 16 kDa protein co‐isolating with gap junctions from brain tissue belonging to the class of proteolipids of the vacuolar H<sup>+</sup>‐ATPases

Dermietzel, Rolf; Völker, Michael; Hwang, T. K.; Berzborn, Richard J.; Meyer, Helmut E.

doi:10.1016/0014-5793(89)80917-2

Cited by 42 publications

(6 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For these and other reasons, acceptance of the M r 16,000 protein as a bonafide channel-forming protein has been slow. Recent data from another laboratory describe a M r 16,000 protein identified in brain gap junction membranes with homology to a proton transporting ATPase (80). Any relationship between this and the previously reported M r 16,000 protein (4,79) remains to be established.…”

Section: Protein Subunitsmentioning

confidence: 87%

The Hormone-Induced Regulation of Contact-Dependent Cell-Cell Communication by Phosphorylation*

1990

View full text Add to dashboard Cite

Although there is insufficient evidence to propose an elaborate paradigm for the regulation of connexon gating, a simple model emerges from results of studies done to date. Basically, this centers around the most consistent findings: namely, that activation of pkA has an enhancing effect on cell communication while activation of pkC decreases that process. This fits well the reported phenomena associated with gap junctions, particularly those involving growth control. For example growth factors, including tumor promoters which work via pkC, usually reduce cell-cell communication whereas agents that decrease growth often raise cellular cAMP levels, which can lead to increased communication. It can be argued that this model is too simple because it fails to take into account other intracellular agents that are thought to alter junctional gating: cytoplasmic acidification, cellular free Ca2+, tyrosine protein kinases, and tentatively, pkG. Proton and Ca2+ transporting systems are mainly activated by serine/threonine protein kinases such as pkA and pkC. Some ion channels are not regulated by phosphorylation but instead are modulated by other ions. However, at the moment there is no evidence as to which ion-specific channels mediate the changes in cellular pH or Ca2+ that cause a loss in communication. Neither is it known whether pH or Ca2+ levels are in vivo regulators of the junctions. This is especially so as fairly high levels of injected Ca2+ pass through the gap junctions of viable cells. The role of tyrosine protein kinases in connexon gating may involve interaction with the pkA and pkC regulatory cascades. For example, the pkA inhibitor protein (pkI) is 80-90% inactivated when tyrosine-phosphorylated by the EGF receptor or pp50v-src (D. Walsh, personal communication). In this situation, activity of the C subunit of pkA could be enhanced, or the lifetime of its catalytic activity extended. In some systems, pp60v-src is known to activate the pkC pathway. Thus, tyrosine protein kinases may invoke pkA and pkC pathways; however, the amplitude of enzyme activation and the temporal kinetics of this process are unknown. The fact that gap junctions are regulated at the transcription level and probably at the protein level by protein kinases is of major interest. This is especially so as the only known molecular mechanism that gap junctional communication mediates is the activation of cAMP-dependent protein kinases by hormone-induced signals passed from receptor-bearing cells to receptorless partners.

show abstract

Section: Protein Subunitsmentioning

confidence: 87%

The Hormone-Induced Regulation of Contact-Dependent Cell-Cell Communication by Phosphorylation*

1990

View full text Add to dashboard Cite

show abstract

“…Although its primary amino acid sequence is not directly related to any known proteins, hydrophobicity plots for MAL show very high structural homology to other members of the proteolipid family such as PMP22 [28,30], which are associated with the control of cell growth and/or differentiation. Proteolipids seem to play a role in ion conduction and have been shown to be associated to gap junctions [9,16]. PMP-22 (peripheral membrane protein) has a dual role assigned to it in the development of the peripheral nervous system.…”

Section: Discussionmentioning

confidence: 99%

MAL mRNA is induced during the differentiation of human embryonal carcinoma cells into neurons and is also localised within specific regions of the human brain

et al. 1997

View full text Add to dashboard Cite

“…A protein with significant identity to the ATAATTACAATAAAAAAATTTTTTCTCATATACACGCACCAACCCCCTTCATATATGTAT VOL. 10,1990 on bovine proteolipid has been isolated from gap junction preparations (9), suggesting that proteolipids could have multiple roles in the cell. The exact functional relationship between these predicted yeast proteolipid genes and the vacuolar network remains to be determined by further genetic and biochemical analysis.…”

Section: Discussionmentioning

confidence: 99%

Expression of a proteolipid gene from a high-copy-number plasmid confers trifluoperazine resistance to Saccharomyces cerevisiae.

Shih¹,

Kwong²,

Montalvo³

et al. 1990

Mol. Cell. Biol.

View full text Add to dashboard Cite

A wild-type haploid yeast strain was transformed with a library of wild-type yeast DNA fragments ligated into a high-copy-number plasmid vector (YEp24). The pooled URA+ transformants were plated on rich medium containing a lethal concentration of trifluoperazine (TFP) (4,26). The 530-base-pair (bp) PvuII-ClaI fragment (Fig. 1) was used as the hybridization probe for the TFP3 locus. The probe for chromosome XIII was the ILV2 gene, provided by S. Carl Falco (10).An insertion and disruption construction was made by digesting pTFP3-40 at the unique PvuII site at amino acid 24

show abstract

A 16 kDa protein co‐isolating with gap junctions from brain tissue belonging to the class of proteolipids of the vacuolar H⁺‐ATPases

Cited by 42 publications

References 21 publications

The Hormone-Induced Regulation of Contact-Dependent Cell-Cell Communication by Phosphorylation*

The Hormone-Induced Regulation of Contact-Dependent Cell-Cell Communication by Phosphorylation*

MAL mRNA is induced during the differentiation of human embryonal carcinoma cells into neurons and is also localised within specific regions of the human brain

Expression of a proteolipid gene from a high-copy-number plasmid confers trifluoperazine resistance to Saccharomyces cerevisiae.

Contact Info

Product

Resources

About

A 16 kDa protein co‐isolating with gap junctions from brain tissue belonging to the class of proteolipids of the vacuolar H+‐ATPases

Cited by 42 publications

References 21 publications

The Hormone-Induced Regulation of Contact-Dependent Cell-Cell Communication by Phosphorylation*

The Hormone-Induced Regulation of Contact-Dependent Cell-Cell Communication by Phosphorylation*

MAL mRNA is induced during the differentiation of human embryonal carcinoma cells into neurons and is also localised within specific regions of the human brain

Expression of a proteolipid gene from a high-copy-number plasmid confers trifluoperazine resistance to Saccharomyces cerevisiae.

Contact Info

Product

Resources

About

A 16 kDa protein co‐isolating with gap junctions from brain tissue belonging to the class of proteolipids of the vacuolar H⁺‐ATPases