A Non‐Competitive Inhibitor of VCP/p97 and VPS4 Reveals Conserved Allosteric Circuits in Type I and II AAA ATPases

Pöhler, Robert; Krahn, Jan H.; Boom, Johannes van den; Dobrynin, Grzegorz; Kaschani, Farnusch; Eggenweiler, Hans-Michael; Zenke, Frank T.; Kaiser, Markus; Meyer, Hemmo

doi:10.1002/anie.201711429

Cited by 25 publications

(23 citation statements)

References 20 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The crystal structures of mammalian VPS4B and its yeast ortholog show similarities in their ATPase domains (Scott et al, 2005;Xiao et al, 2007;Hartmann et al, 2008;Inoue et al, 2008;Sun et al, 2017). Recent attempts to develop inhibitors for VCP/p97 (a distinct member of the type II AAA + ATPase family, overexpressed in many cancers) identified two compounds that inhibit yeast VPS4 (Zhang et al, 2016) and human VPS4B (Pohler et al, 2018). Even though the low selectivity of these molecules excludes their usage in the VPS4A+B synthetic lethality-based approach, it confirms the druggability of VPS4 and yields optimism for the future development of a selective VPS4 inhibitor.…”

Section: Of 21mentioning

confidence: 99%

Synthetic lethality between VPS 4A and VPS 4B triggers an inflammatory response in colorectal cancer

et al. 2020

View full text Add to dashboard Cite

Somatic copy number alterations play a critical role in oncogenesis. Loss of chromosomal regions containing tumor suppressors can lead to collateral deletion of passenger genes. This can be exploited therapeutically if synthetic lethal partners of such passenger genes are known and represent druggable targets. Here, we report that VPS4B gene, encoding an ATPase involved in ESCRT-dependent membrane remodeling, is such a passenger gene frequently deleted in many cancer types, notably in colorectal cancer (CRC). We observed downregulation of VPS4B mRNA and protein levels from CRC patient samples. We identified VPS4A paralog as a synthetic lethal interactor for VPS4B in vitro and in mouse xenografts. Depleting both proteins profoundly altered the cellular transcriptome and induced cell death accompanied by the release of immunomodulatory molecules that mediate inflammatory and anti-tumor responses. Our results identify a pair of novel druggable targets for personalized oncology and provide a rationale to develop VPS4 inhibitors for precision therapy of VPS4B-deficient cancers.

show abstract

Section: Of 21mentioning

confidence: 99%

Synthetic lethality between VPS 4A and VPS 4B triggers an inflammatory response in colorectal cancer

et al. 2020

View full text Add to dashboard Cite

show abstract

“…In principle, chemical inhibitors of AAA proteins can be identified that target either the nucleotide-binding site or an allosteric site. An allosteric inhibitor-binding site has been characterized for VCP and the vacuolar protein sorting-associated protein 4 (VPS4) 15,16 . However, it is unclear if an equivalent site exists in other AAA proteins.…”

Section: Introductionmentioning

confidence: 99%

Designing a chemical inhibitor for the AAA protein spastin using active site mutations

et al. 2019

View full text Add to dashboard Cite

Spastin is a microtubule-severing AAA (ATPases associated with diverse cellular activities) protein needed for cell division and intracellular vesicle transport. Currently, we lack chemical inhibitors to probe spastin function in such dynamic cellular processes. To design a chemical inhibitor of spastin we tested selected heterocyclic-scaffolds against wildtype protein and constructs with engineered mutations in the nucleotide-binding site that do not substantially disrupt ATPase activity. These data, along with computational docking, guided improvements in compound potency and selectivity and led to spastazoline, a pyrazolyl-pyrrolopyrimidine-based cell-permeable probe for spastin. These studies also identified spastazoline resistance-conferring point mutations in spastin. Spastazoline, along with matched inhibitor-sensitive and inhibitor-resistant cell lines we generated, were used in parallel experiments to dissect spastin-specific phenotypes in dividing cells. Together, our findings suggest how chemical probes for AAA proteins, along with inhibitor resistance-conferring mutations, can be designed and used to dissect dynamic cellular processes.

show abstract

“…8,9 Several inhibitors of the D2 ATPase domain of p97 are available. [15][16][17][18][19][20][21] The most used p97 inhibitors identified recently, DBeQ, NMS-873 and MSC1094308 16,19,20 were isolated by screening compounds that inhibit the ATPase activity in vitro. Since p97 participates in a wide range of cellular processes, treatment with these drugs cause major cellular defects, including cell death.…”

Section: Introductionmentioning

confidence: 99%

Small-Molecule Modulators of the ATPase VCP/p97 Affect Specific p97 Cellular Functions

et al. 2019

View full text Add to dashboard Cite

VCP/p97 belongs to the AAA+ ATPase family and has an essential role in several cellular processes ranging from cell division to protein homeostasis. Compounds targeting p97 inhibit the main ATPase domain and cause cell death. Here, using PNA-encoded chemical libraries, we have identified two small molecules that target the regulatory domain of p97, comprising the N-terminal and the D1 ATPase domains, and do not cause cell death. One molecule, NW1028, inhibits the degradation of a p97-dependent reporter, whereas the other, NW1030, increases it. ATPase assays show that NW1028 and NW1030 do not affect the main catalytic domain of p97. Mapping of the binding site using a photo-affinity conjugate points to a cleft at the interface of the N-terminal and the D1 ATPase domains. We have therefore discovered two new compounds that bind to the regulatory domain of p97 and modulate specific p97 cellular functions. Using these compounds, we have revealed a role for p97 in the regulation of mitotic spindle orientation in HeLa cells.Chemicals used in this study are: MG132 and DBeQ (Sigma-Aldrich), NMS-873 (Xcessbio), chloroquine (Enzo lifescience), cycloheximide (Millipore), puromycin (Sigma-Aldrich), G418 (InvivoGen) and luciferin (AppliChem). Cell culture and transfections. The following cell lines were gifts from specified groups: HeLa cells expressing UbG76V-GFP and ODD-LUC, gift of T. Chou 16 (Harbor-UCLA Medical Center and Los Angeles Biomedical Research Institute, USA); HEK 293T, RPE1, HeLa, HeLa H2B-mCherry/GFP-α-tubulin41 from P. Meraldi (University of Geneva, Switzerland); MEF cells expressing mCherry-GFP-LC3b, from P. Taylor (Tresse et al., 2010) (St. Jude Children's Research Hospital, USA).Cell lines were grown in Dulbecco's modified eagle medium (Gibco DMEM) supplemented with FCS 10%, penicillin 100units/ml and streptomycin 100mg/ml) at 37°C with 5% CO2 in a humified incubator. HEK 293T cells were supplemented with 1% Glutamine. HeLa cells expressing UbG76V-GFP and ODD-LUC were selected with 2.5µg/ml puromycin and 0.1mg/ml G418(Chou and Deshaies, 2011). Transient expression was performed using lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol.Plasmids and oligonucleotides. The following constructs were used in this work for protein expression and site-directed mutagenesis: pQE9-His-p97deltaD2 was provided by Addgene (ID17229); pET15-His-p97 and pET24b-His-p97ND1L was provided by TF. Chou 34 (Harbor-UCLA Medical Center and Los Angeles Biomedical Research Institute, USA).The mutant p97 E305Q were obtained by site-directed mutagenesis using the following oligonucleotides: p97 E305Q (forward: GCCATCATCTTCATTGAT CAGCTAGATGCCATCGCTCCC; reverse: GGGAGCGATGGCATCTAGCTGATCAATGAAGATGATGGC). The following oligonucleotides were used to verify the site-directed mutagenesis:ATGGCTTCTGGAGCCGATTC, TTACCCGATGTCTTCCCAGGTTAC, GTAACCTGGGAAGACATCGGG, GGAACAGGTAGCCAATGAGACTC and GGCCATCCGTGAATCCATCG.Recombinant protein expression and purification. All recombinant proteins (ND1L and p97 E305Q) were expressed in E.co...

show abstract

A Non‐Competitive Inhibitor of VCP/p97 and VPS4 Reveals Conserved Allosteric Circuits in Type I and II AAA ATPases

Cited by 25 publications

References 20 publications

Synthetic lethality between VPS 4A and VPS 4B triggers an inflammatory response in colorectal cancer

Synthetic lethality between VPS 4A and VPS 4B triggers an inflammatory response in colorectal cancer

Designing a chemical inhibitor for the AAA protein spastin using active site mutations

Small-Molecule Modulators of the ATPase VCP/p97 Affect Specific p97 Cellular Functions

Contact Info

Product

Resources

About