ACSS3 represses prostate cancer progression through downregulating lipid droplet-associated protein PLIN3

Zhou, Lijie; Song, Zhengshuai; Hu, Junyi; Liu, Lilong; Hou, Yaxin; Zhang, Xiaoping; Yang, Xiong; Chen, Ke

doi:10.7150/thno.49384

Cited by 70 publications

(63 citation statements)

References 27 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Thus, our Acss3 –/– mice represented an excellent model for studying the function of ACSS3 protein in vivo. Our mice phenotype was consistent with a recent publication that global knockout of Acss3 slightly increased the body weight of the mice at young age 41 . However, that study did not analyse the metabolic function of ACSS3 in vivo.…”

Section: Discussionsupporting

confidence: 92%

ACSS3 in brown fat drives propionate catabolism and its deficiency leads to autophagy and systemic metabolic dysfunction

Jia

Chen

et al. 2022

Clinical & Translational Med

View full text Add to dashboard Cite

Propionate is a gut microbial metabolite that has been reported to have controversial effects on metabolic health. Here we show that propionate is activated by acyl‐CoA synthetase short‐chain family member 3 (ACSS3), located on the mitochondrial inner membrane in brown adipocytes. Knockout of Acss3 gene (Acss3–/–) in mice reduces brown adipose tissue (BAT) mass but increases white adipose tissue (WAT) mass, leading to glucose intolerance and insulin resistance that are exacerbated by high‐fat diet (HFD). Intriguingly, Acss3–/– or HFD feeding significantly elevates propionate levels in BAT and serum, and propionate supplementation induces autophagy in cultured brown and white adipocytes. The elevated levels of propionate in Acss3–/– mice similarly drive adipocyte autophagy, and pharmacological inhibition of autophagy using hydroxychloroquine ameliorates obesity, hepatic steatosis and insulin resistance of the Acss3–/– mice. These results establish ACSS3 as the key enzyme for propionate metabolism and demonstrate that accumulation of propionate promotes obesity and Type 2 diabetes through triggering adipocyte autophagy.

show abstract

Section: Discussionsupporting

confidence: 92%

ACSS3 in brown fat drives propionate catabolism and its deficiency leads to autophagy and systemic metabolic dysfunction

Jia

Chen

et al. 2022

Clinical & Translational Med

View full text Add to dashboard Cite

show abstract

“…Furthermore, we developed a 12-LMRG recurrence signature using 334 early-stage LUAD patients from the TCGA database. This signature includes LDHA, NSDHL, TP53INP2, FLT1, IRS1, ELOVL7, AGPS, FHL2, MED6, PLIN3, VDAC1, and SULT2B1, most of which were revealed to be correlated with tumor proliferation and progression (39)(40)(41)(42)(43)(44)(45)(46)(47). For instance, NSDHL, a crucial enzyme for cholesterol biosynthesis, has been reported to promote metastasis in triple-negative breast cancer (48).…”

Section: Discussionmentioning

confidence: 99%

Clinical Significance and Immunometabolism Landscapes of a Novel Recurrence-Associated Lipid Metabolism Signature In Early-Stage Lung Adenocarcinoma: A Comprehensive Analysis

et al. 2022

View full text Add to dashboard Cite

BackgroundThe early-stage lung adenocarcinoma (LUAD) incidence has increased with heightened public awareness and lung cancer screening implementation. Lipid metabolism abnormalities are associated with lung cancer initiation and progression. However, the comprehensive features and clinical significance of the immunometabolism landscape and lipid metabolism-related genes (LMRGs) in cancer recurrence for early-stage LUAD remain obscure.MethodsLMRGs were extracted from Gene Set Enrichment Analysis (GSEA) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. Samples from The Cancer Genome Atlas (TCGA) were used as training cohort, and samples from four Gene Expression Omnibus (GEO) datasets were used as validation cohorts. The LUAD recurrence-associated LMRG molecular pattern and signature was constructed through unsupervised consensus clustering, time-dependent receiver operating characteristic (ROC), and least absolute shrinkage and selection operator (LASSO) analyses. Kaplan-Meier, ROC, and multivariate Cox regression analyses and prognostic meta-analysis were used to test the suitability and stability of the signature. We used Gene Ontology (GO), KEGG pathway, immune cell infiltration, chemotherapy response analyses, gene set variation analysis (GSVA), and GSEA to explore molecular mechanisms and immune landscapes related to the signature and the potential of the signature to predict immunotherapy or chemotherapy response.ResultsFirst, two LMRG molecular patterns were established, which showed diverse prognoses and immune infiltration statuses. Then, a 12-gene signature was identified, and a risk model was built. The signature remained an independent prognostic parameter in multivariate Cox regression and prognostic meta-analysis. In addition, this signature stratified patients into high- and low-risk groups with significantly different recurrence rates and was well validated in different clinical subgroups and several independent validation cohorts. The results of GO and KEGG analyses and GSEA showed that there were differences in multiple lipid metabolism, immune response, and drug metabolism pathways between the high- and low-risk groups. Further analyses revealed that the signature-based risk model was related to distinct immune cell proportions, immune checkpoint parameters, and immunotherapy and chemotherapy response, consistent with the GO, KEGG, and GSEA results.ConclusionsThis is the first lipid metabolism-based signature for predicting recurrence, and it could provide vital guidance to achieve optimized antitumor for immunotherapy or chemotherapy for early-stage LUAD.

show abstract

“…Quantitative real‐time PCR was executed as previously described 76 . The primer sequences for AR‐V7 were as follows: Forward, 5′‐CCATCTTGTCGTCTTCGGAAATGTTA‐3′, Reverse, 5′‐TTTGAATGAGGCAAGTCAGCCTTTCT‐3.…”

Section: Methodsmentioning

confidence: 99%

Melatonin inhibits lipid accumulation to repress prostate cancer progression by mediating the epigenetic modification of CES1

Zhou

Zhang

Yang

et al. 2021

Clinical & Translational Med

Self Cite

View full text Add to dashboard Cite

Background Androgen deprivation therapy (ADT) is the main clinical treatment for patients with advanced prostate cancer (PCa). However, PCa eventually progresses to castration‐resistant prostate cancer (CRPC), largely because of androgen receptor variation and increased intratumoral androgen synthesis. Several studies have reported that one abnormal lipid accumulation is significantly related to the development of PCa. Melatonin (MLT) is a functionally pleiotropic indoleamine molecule and a key regulator of energy metabolism. The aim of our study is finding the links between CRPC and MLT and providing the basis for MLT treatment for CRPC. Methods We used animal CRPC models with a circadian rhythm disorder, and PCa cell lines to assess the role of melatonin in PCa. Results We demonstrated that MLT treatment inhibited tumor growth and reversed enzalutamide resistance in animal CRPC models with a circadian rhythm disorder. A systematic review and meta‐analysis demonstrated that MLT is positively associated with an increased risk of developing advanced PCa. Restoration of carboxylesterase 1 (CES1) expression by MLT treatment significantly reduced lipid droplet (LD) accumulation, thereby inducing apoptosis by increasing endoplasmic reticulum stress, reducing de novo intratumoral androgen synthesis, repressing CRPC progression and reversing the resistance to new endocrine therapy. Mechanistic investigations demonstrated that MLT regulates the epigenetic modification of CES1. Ces1‐knockout (Ces −/− ) mice verified the important role of endogenous Ces1 in PCa. Conclusions Our findings provide novel preclinical and clinical information about the role of melatonin in advanced PCa and characterize the importance of enzalutamide combined with MLT administration as a therapy for advanced PCa.

show abstract

ACSS3 represses prostate cancer progression through downregulating lipid droplet-associated protein PLIN3

Cited by 70 publications

References 27 publications

ACSS3 in brown fat drives propionate catabolism and its deficiency leads to autophagy and systemic metabolic dysfunction

ACSS3 in brown fat drives propionate catabolism and its deficiency leads to autophagy and systemic metabolic dysfunction

Clinical Significance and Immunometabolism Landscapes of a Novel Recurrence-Associated Lipid Metabolism Signature In Early-Stage Lung Adenocarcinoma: A Comprehensive Analysis

Melatonin inhibits lipid accumulation to repress prostate cancer progression by mediating the epigenetic modification of CES1

Contact Info

Product

Resources

About