Anaerobic p -Coumarate Degradation by Rhodopseudomonas palustris and Identification of CouR, a MarR Repressor Protein That Binds p -Coumaroyl Coenzyme A

Abstract

The phenylpropanoid p-coumarate and structurally related aromatic compounds are produced in large amounts by green plants and are excellent carbon sources for many soil bacteria. Aerobic bacteria remove the acyl side chain from phenylpropanoids to leave an aromatic aldehyde, which then enters one of several possible central pathways of benzene ring degradation. We investigated the pathway for the anaerobic degradation of p-coumarate by the phototrophic bacterium Rhodopseudomonas palustris and found that it also follows this metabolic logic. We characterized enzymes for the conversion of p-coumarate to p-hydroxybenzaldehyde and acetyl coenzyme A (acetyl-CoA) encoded by the couAB operon. We also identified a MarR family transcriptional regulator that we named CouR. A couR mutant had elevated couAB expression. In addition, His-tagged CouR bound with high affinity to a DNA fragment encompassing the couAB promoter region, and binding was abrogated by the addition of nanomolar quantities of p-coumaroyl-CoA but not by p-coumarate. Footprinting demonstrated binding of CouR to an inverted repeat sequence that overlaps the ؊10 region of the couAB promoter. Our results provide evidence for binding of a CoA-modified aromatic compound by a MarR family member. Although the MarR family is widely distributed in bacteria and archaea and includes over 12,000 members, ligands have been identified for relatively few family members. Here we provide biochemical evidence for a new category of MarR ligand.

BadR and BadM Proteins Transcriptionally Regulate Two Operons Needed for Anaerobic Benzoate Degradation by Rhodopseudomonas palustris

“…Although MarR proteins were originally described as regu- lators for multidrug and stress resistance genes, e.g., MarR for marAB in E. coli (31) and MexR for mexAB in P. aeruginosa (32), there are also MarR regulators that control aromatic compound metabolism (33)(34)(35)(36)(37). In general, the ligands for these proteins are ϳ100-Da-sized small molecules like protocatechuate and 4-hydroxybenzoic acid, but recently a number of studies showed that there are MarR members which bind CoA-thioesterified phenyl propanoids, including p-coumaroyl-CoA for CouR from R. palustris (20,38,39). We show that BadR binds a nonphenolic CoA-thioesterified compound.…”

“…Next, badR together with the gdh (glyceraldehyde-3-phosphase dehydrogenase) promoter was cut out by KpnI-XbaI digestion and ligated into pBBR1MCS-2 (22). The C-terminal His 6 -tagged BadM expression plasmid pQF5016b.badM was constructed by PCR amplification of badM from genomic DNA using primers badM-F and badM-R, followed by ligation into NcoI-BamHI-digested pQF5016b.rpa1794 plasmid (20). The plasmid constructions were confirmed by DNA sequencing.…”

“…Cell pellets were suspended in buffer (20 mM Tris, pH 7.9), 100 mM NaCl, and 10% glycerol) and lysed by sonication. The lysate was centrifuged, and the resulting supernatant was mixed with Ni-nitrilotriacetic acid (NTA) agarose (Qiagen, Valencia, CA) for 1 h. The agarose was washed with increasing amounts of imidazole (20,50, and 100 mM), and the His-tagged fusion protein was subsequently eluted with 200 and 500 mM imidazole. Purified BadR was desalted with HiTrap desalting columns (GE Healthcare, Pittsburgh, PA), eluted with 20 mM Tris (pH 7.5), 50 mM KCl, 1 mM dithiothreitol, and 10% glycerol, and stored at Ϫ80°C.…”

“…Primer sequences are given in Table 2. To construct the N-terminal His 6 -tagged BadR overexpression plasmid pQF5016b.badR, badR was PCR amplified from genomic DNA using primers pETbadR-F GCCGGATCCCAGCCGGCGTTGTTGACCAG badR in-frame deletion badR-delta2 GCGCCTTGACCAAAGTCATTCCAGCGCCATCATCAACCATCTTG badR in-frame deletion badR-delta3 GCGTCAAGATGGTTGATGATGGCGCTGGAATGACTTTGGTCAAG badR in-frame deletion badR-delta4 CCTCTAGAAGGCTCATCTTGGCGCACAG badR in-frame deletion and pETbadR-R and cloned into NcoI-BamHI-digested pQF5016b.rpa1794 plasmid (20). To construct pBBR1MCS-2badR for BadR expression in R. palustris, the badR gene was PCR amplified with pBBRbadR-F and pBBRbadR-R primers and cloned into HindIII-XbaI-digested pBBPgdh (21).…”

Characterization of p -Hydroxycinnamate Catabolism in a Soil Actinobacterium

“…Finally, CouR is similar to CouR of Rhodopseudomonas palustris and FerC of Sphingobium sp. strain SYK-6, two MarR family transcriptional regulators whose ligands are p-hydroxycinnamoyl-CoAs (33,34). Therefore, it is likely that CouR represses the transcription of the cou genes and that p-hydroxycinnamoyl-CoA acts as its effector.…”