Antibiotic resistance genes in layer farms and their correlation with environmental samples

Zhu, Ting; Chen, Tao; Cao, Zhen; Zhong, Shan; Wen, Xin; Mi, Jiandui; Ma, Baohua; Zou, Yongde; Zhang, Na; Liao, Xindi; Wang, Yan; Wu, Yinbao

doi:10.1016/j.psj.2021.101485

Cited by 31 publications

(14 citation statements)

References 50 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although most antibiotics are prohibited during the laying period, the use of antibiotics during the incubation and growth periods is allowed for laying hens. During growth and development, the acquisition of antibiotic resistance genes is likely important [ 48 ].…”

Section: Discussionmentioning

confidence: 99%

Campylobacter spp. in Eggs and Laying Hens in the North-East of Tunisia: High Prevalence and Multidrug-Resistance Phenotypes

Gharbi

Béjaoui

Hamda

et al. 2022

Veterinary Sciences

View full text Add to dashboard Cite

Despite the importance of eggs in the human diet, and unlike other products, for which food safety risks are widely investigated, information on the occurrence of Campylobacter and antimicrobial resistance in eggs and layer hen flocks is lacking in Tunisia. This study was conducted to determine the occurrence of Campylobacter and the antimicrobial resistance in layer hens and on eggshells. Thus, 366 cloacal swabs and 86 eggshell smear samples were collected from five layer hen farms in the North-East of Tunisia. The occurrence of Campylobacter infection, and the antimicrobial resistance rates and patterns, were analyzed. The occurrence rates of Campylobacter infection in laying hens and eggshells were 42.3% and 25.6%, respectively, with a predominance of C. jejuni (68.4%, 81.9%), followed by C. coli (31.6%, 18.2%). The antimicrobial susceptibility testing revealed high resistance rates against macrolides, tetracycline, quinolones, β-lactams, and chloramphenicol, with percentages ranging from 35.5% to 100%. All isolates were multidrug resistant (MDR) and five resistance patterns were observed. These results emphasized the risk to consumer health and the need to establish a surveillance strategy to control and prevent the emergence and the spread of resistant strains of Campylobacter in poultry and humans.

show abstract

Section: Discussionmentioning

confidence: 99%

Campylobacter spp. in Eggs and Laying Hens in the North-East of Tunisia: High Prevalence and Multidrug-Resistance Phenotypes

Gharbi

Béjaoui

Hamda

et al. 2022

Veterinary Sciences

View full text Add to dashboard Cite

show abstract

“…The 16S rRNA-specific primers for qPCR included the forward primer CGGCAACGAGCGCAACCC and the reverse primer CCATTGTAGCACGTGTGTAGCC . The construction of recombinant plasmids carrying ARGs and the calculation method for absolute abundance were as described in a previous study ( 57 ). All qPCRs were run on a BioRad CFX96 PCR System (BioRad, USA).…”

Section: Methodsmentioning

confidence: 99%

Recovery of the Structure and Function of the Pig Manure Bacterial Community after Enrofloxacin Exposure

Chen

Xie

et al. 2022

Microbiol Spectr

Self Cite

View full text Add to dashboard Cite

show abstract

“…Epidemiological studies in poultry have been primarily focused on single breeding periods and may have underestimated disease impacts [11,16]. There are five chicken breeding growth cycles: the brooding (BP), growing (GP), early laying (EL), peak laying (PL) and late laying (LL) periods [17]. There have been few studies that traced persistence of ceftiofur-resistant E. coli across the chicken growth cycle, and these were carried out with broiler chickens.…”

Section: Introductionmentioning

confidence: 99%

“…A longitudinal monitoring study of ESBL/AmpC-producing and fosfomycinresistant E. coli in 8 broiler farms indicated the presence of ESBL-EC between days 20 and 25 that then increased in the fattening period at days 36 to 38 [19]. In chicken breeding farms, only a single study has analyzed ARG diversity and abundance in different breeding periods [17]. In nine farms in Guangdong Province, the ranked prevalence of ARG abundance in manure samples was BP > LL > GP > EL> PL [17].…”

Section: Introductionmentioning

confidence: 99%

“…In chicken breeding farms, only a single study has analyzed ARG diversity and abundance in different breeding periods [17]. In nine farms in Guangdong Province, the ranked prevalence of ARG abundance in manure samples was BP > LL > GP > EL> PL [17]. However, the prevalence and persistence of ceftiofur-resistant E. coli was not investigated.…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Prevalence and Persistence of Ceftiofur-Resistant Escherichia coli in A Chicken Layer Breeding Program

Liao

et al. 2022

Animals

View full text Add to dashboard Cite

We determined the longitudinal persistence of ceftiofur-resistant Escherichia coli from a chicken breeding farm in China. A total of 150 samples were collected from 5 breeding periods in a flock of layer hens, and the prevalence of ceftiofur-resistant E. coli fluctuated across the 5 chicken breeding stages: eggs, 3.33%; growing period, 100%; early laying period, 36.7%; peak laying period, 66.7% and late laying period, 80%. The most prevalent ceftiofur resistance genes were blaCTX-M-55, blaCMY and blaNDM, and ST101 was the most prevalent and persistent sequence type across the breeding periods. Our results indicated that this breeder flock was heavily contaminated by ST101 ceftiofur-resistant E. coli and that its presence should be intensively monitored on chicken farms.

show abstract

Antibiotic resistance genes in layer farms and their correlation with environmental samples

Cited by 31 publications

References 50 publications

Campylobacter spp. in Eggs and Laying Hens in the North-East of Tunisia: High Prevalence and Multidrug-Resistance Phenotypes

Campylobacter spp. in Eggs and Laying Hens in the North-East of Tunisia: High Prevalence and Multidrug-Resistance Phenotypes

Recovery of the Structure and Function of the Pig Manure Bacterial Community after Enrofloxacin Exposure

Prevalence and Persistence of Ceftiofur-Resistant Escherichia coli in A Chicken Layer Breeding Program

Contact Info

Product

Resources

About