Biological control of Paecilomyces formosus, the causal agent of dieback and canker diseases of pistachio by two strains of Streptomyces misionensis

Torabi, Abdollah; Bonjar, Gholam Hosein Shahidi; Abdolshahi, Roohollah; Pournamdari, Mostafa; Saadoun, Ismail; Barka, Essaïd Ait

doi:10.1016/j.biocontrol.2019.104029

Cited by 24 publications

(8 citation statements)

References 45 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Nevertheless, we cannot ignore the fact that Paecilomyces has been associated with several human infectious diseases in immunosuppressed patients [ 62 , 63 ] and has also been described as a phytopathogen. P. variotii was described by Aminaee et al [ 64 ], as the causal agent of pistachio dieback, although subsequent molecular and phylogenetic studies reported that it was caused by P. formosus (Sakag., May., Inoue and Tada) Houbraken and Samsoninstead [ 65 ]. According to the map shown in Figure 1 , there are few species of Paecilomyces responsible for the biological control of pests and diseases.…”

Section: Introductionmentioning

confidence: 99%

Paecilomyces and Its Importance in the Biological Control of Agricultural Pests and Diseases

Moreno-Gavíra

Huertas

Diánez

et al. 2020

Plants

View full text Add to dashboard Cite

Incorporating beneficial microorganisms in crop production is the most promising strategy for maintaining agricultural productivity and reducing the use of inorganic fertilizers, herbicides, and pesticides. Numerous microorganisms have been described in the literature as biological control agents for pests and diseases, although some have not yet been commercialised due to their lack of viability or efficacy in different crops. Paecilomyces is a cosmopolitan fungus that is mainly known for its nematophagous capacity, but it has also been reported as an insect parasite and biological control agent of several fungi and phytopathogenic bacteria through different mechanisms of action. In addition, species of this genus have recently been described as biostimulants of plant growth and crop yield. This review includes all the information on the genus Paecilomyces as a biological control agent for pests and diseases. Its growth rate and high spore production rate in numerous substrates ensures the production of viable, affordable, and efficient commercial formulations for agricultural use.

show abstract

Section: Introductionmentioning

confidence: 99%

Paecilomyces and Its Importance in the Biological Control of Agricultural Pests and Diseases

Moreno-Gavíra

Huertas

Diánez

et al. 2020

Plants

View full text Add to dashboard Cite

show abstract

“…We do not have many data regarding biological control of pistachio diseases. In Iran, promising results were obtained with the usage of Streptomyces misionensis to control Paecilomyces formosus , the causal agent of pistachio canker and dieback [ 23 ] and strains of Streptomyces and B. subtilis against Phytophthora spp. agent of pistachio gummosis [ 24 , 25 , 26 ].…”

Section: Discussionmentioning

confidence: 99%

Potential Role of Biocontrol Agents for Sustainable Management of Fungal Pathogens Causing Canker and Fruit Rot of Pistachio in Italy

2022

View full text Add to dashboard Cite

Pistachio (Pistacia vera) is an important Mediterranean crop. In Italy, pistachio is cultivated in the southern regions, of which Sicily is the main production area. Recently, the phytopathological situation of this crop has started to be updated, and new diseases have been discovered, studied, and reported. Botryosphaeriaceae spp. and Leptosillia pistaciae are major canker/rot pathogens, and Cytospora pistaciae and Eutypa lata have been reported as minor canker pathogens. In this paper, we evaluated different biological control agents, belonging to Trichoderma asperellum, T. atroviride and T. harzianum, as well as some Bacillus amyloliquefaciens strains, against above-mentioned pathogens. Results of dual culture assays showed that all the biological products, both fungi and bacteria, were able to inhibit the mycelial growth of the pathogens in vitro. Experiments using detached twigs showed no effect of biocontrol agents in reducing infections, except for Neofusicoccum hellenicum treated with T. harzianum T22 and Leptosillia pistaciae treated with B. amyloliquefaciens D747. Results of detached fruit experiments showed an efficacy ranging from 32.5 to 66.9% of all the biological products in reducing the lesions caused by N. mediterraneum. This study provides basic information for future research on biological control of pistachio diseases and future prospects for search of more effective biological control agents for canker diseases than those studied here.

show abstract

“…About 100 mg of fungal mycelia was grounded to powder by mortar and pestle after freezing using liquid nitrogen. The CTAB (Cetyltrimethylammonium Bromide) method was used to DNA extract genomic from mycelia [52]. For molecular identification, primers ITS5 (GGAAGTAAAAGTCGTAACAAGG) and ITS4 (TCCTCCGCTTATTGATATGC) were used to amplify ITS1, 5.8S, ITS2-rRNA from DNA [53].…”

Section: Isolation and Identification Of Endophytic Fungimentioning

confidence: 99%

Evaluation of Phoma sp. Biomass as an Endophytic Fungus for Synthesis of Extracellular Gold Nanoparticles with Antibacterial and Antifungal Properties

et al. 2022

View full text Add to dashboard Cite

The aim of our study was to examine the different concentrations of AuNPs as a new antimicrobial substance to control the pathogenic activity. The extracellular synthesis of AuNPs performed by using Phoma sp. as an endophytic fungus. Endophytic fungus was isolated from vascular tissue of peach trees (Prunus persica) from Baft, located in Kerman province, Iran. The UltraViolet-Visible Spectroscopy (UV–Vis spectroscopy) and Fourier transform infrared spectroscopy provided the absorbance peak at 526 nm, while the X-ray diffraction and transmission electron microscopy images released the formation of spherical AuNPs with sizes in the range of 10–100 nm. The findings of inhibition zone test of Au nanoparticles (AuNPs) showed a desirable antifungal and antibacterial activity against phytopathogens including Rhizoctonia solani AG1-IA (AG1-IA has been identified as the dominant anastomosis group) and Xanthomonas oryzae pv. oryzae. The highest inhibition level against sclerotia formation was 93% for AuNPs at a concentration of 80 μg/mL. Application of endophytic fungus biomass for synthesis of AuNPs is relatively inexpensive, single step and environmentally friendly. In vitro study of the antifungal activity of AuNPs at concentrations of 10, 20, 40 and 80 μg/mL was conducted against rice fungal pathogen R. solani to reduce sclerotia formation. The experimental data revealed that the Inhibition rate (RH) for sclerotia formation was (15, 33, 74 and 93%), respectively, for their corresponding AuNPs concentrations (10, 20, 40 and 80 μg/mL). Our findings obviously indicated that the RH strongly depend on AuNPs rates, and enhance upon an increase in AuNPs rates. The application of endophytic fungi biomass for green synthesis is our future goal.

show abstract

Biological control of Paecilomyces formosus, the causal agent of dieback and canker diseases of pistachio by two strains of Streptomyces misionensis

Cited by 24 publications

References 45 publications

Paecilomyces and Its Importance in the Biological Control of Agricultural Pests and Diseases

Paecilomyces and Its Importance in the Biological Control of Agricultural Pests and Diseases

Potential Role of Biocontrol Agents for Sustainable Management of Fungal Pathogens Causing Canker and Fruit Rot of Pistachio in Italy

Evaluation of Phoma sp. Biomass as an Endophytic Fungus for Synthesis of Extracellular Gold Nanoparticles with Antibacterial and Antifungal Properties

Contact Info

Product

Resources

About