Brain is a potential sanctuary for subtype C HIV-1 irrespective of ART treatment outcome

Abstract

Subtype C HIV-1 is responsible for the largest proportion of people living with HIV-1 infection. However, there is limited information about the roles of the brain and its cell types as a potential sanctuary for this subtype and how the sanctuary may be affected by the administration of anti-retroviral therapy (ART). To address this issue, we collected postmortem brain tissues from ART treated HIV-1 infected Zambian individuals who experienced complete viral suppression and those who did not. Tissues from various brain compartments were collected from each individual as frozen and formalin-fixed paraffin embedded brain specimens, for detection and quantification of HIV-1 genomes and identification of the infected cell type. Genomic DNA and RNA were extracted from frozen brain tissues. The extracted DNA and RNA were then subjected to droplet digital PCR for HIV-1 quantification. RNA/DNAscope in situ hybridization (ISH) for HIV-1 was performed on formalin-fixed paraffin embedded brain tissues in conjugation with immunohistochemistry to identify the infected cell types. Droplet digital PCR revealed that HIV-1 gag DNA and RNA were detectable in half of the cases studied regardless of ART success or failure. The presence of HIV-1 lacked specific tissue compartmentalization since detection was random among various brain tissues. When combined with immunohistochemistry, RNA/DNAscope ISH demonstrated co-localization of HIV-1 DNA with CD68 expressing cells indicative of microglia or peripheral macrophage. Our study showed that brain is a potential sanctuary for subtype C HIV-1, as HIV-1 can be detected in the brain of infected individuals irrespective of ART treatment outcome and no compartmentalization of HIV-1 to specific brain compartments was evident.

Comparative transcriptome analysis of endemic and epidemic Kaposi’s sarcoma (KS) lesions and the secondary role of HIV-1 in KS pathogenesis

“…The role of HIV-1 co-infection in Kaposi's sarcoma pathogenesis Viral copy numbers were determined using RNA Ultra-Sense One-Step quantitative RT-PCR system (Applied Biosystems, Carlsbad, CA) as previously described [55]…”

Lack of CD8+ T-cell co-localization with Kaposi’s sarcoma-associated herpesvirus infected cells in Kaposi’s sarcoma tumors

“…Viral RNA was extracted from plasma according to the QIAamp viral RNA extraction protocol (Qiagen, Hilden, Germany). The viral copy numbers were then determined using RNA Ultra-Sense One-Step quantitative RT-PCR system (Applied Biosystems, Carlsbad, CA) as previously described with universal HIV LTR primers [54] (forward [5′-GCCTCAATAAAGCTTGCCTTGA-3′] and reverse [5′-GGGCGCCACTGCTAGAGA-3′] and probe [5′-FAM/CCAGAGTCACACAACAGACGGGCACA/-BHQ1-3′]) under the following conditions: 50°C for 15 min, 95°C for 2 min, 40 cycles of 95°C for 15 seconds, and 60°C for 30 seconds.…”

The Kaposi’s Sarcoma-Associated Herpesvirus (KSHV) gH/gL Complex Is the Predominant Neutralizing Antigenic Determinant in KSHV-Infected Individuals

“…The HIV-1 serology results were verified using HIV-1-2.0 First Response kit (Premier Medical Corporation Ltd., Mumbai, India). To quantify HIV-1 plasma viral load, the viral RNA was extracted from plasma following the QIAamp viral RNA extraction protocol (Qiagen, Hilden, Germany) and measured using the RNA Ultra-Sense One-Step quantitative real-time PCR (qPCR) system (Applied Biosystems, Foster City, CA, USA) as previously published [33].…”