Cas9-Based Genome Editing in Xenopus tropicalis

Nakayama, Takuya; Blitz, Ira L.; Fish, Margaret; Odeleye, Akinleye O.; Manohar, Sumanth; Cho, Ken W.Y.; Grainger, Robert M.

doi:10.1016/b978-0-12-801185-0.00017-9

Cited by 94 publications

(91 citation statements)

References 44 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The use of 3′ UTRs to drive Cas9 mRNA into germ cells has not been demonstrated in Xenopus, but has been used in zebrafish (MorenoMateos et al, 2015). However, we speculate that the use of highly efficient doses of Cas9-sgRNA complexes or efficient doses of Cas9 mRNA plus sgRNA (see Nakayama et al, 2014) might have an additional advantage over titrated low doses of Cas9-3′UTR fusion mRNAs. The former approach is expected to yield mutations at earlier stages of development (Bhattacharya et al, 2015), resulting in a smaller diversity of alleles being transmitted in the F0 leapfrogged germline.…”

Section: Discussionmentioning

confidence: 99%

“…First, it is essential that a high percentage of genomes in the donor PGCs bear mutations in the targeted gene. A number of recommendations for efficient CRISPR/Cas9-mediated mutagenesis in Xenopus tropicalis are published (Nakayama et al, 2014). We find that the most critical determinants for efficient CRISPR/Cas9 mutagenesis in Xenopus are injection of optimized quantities of Cas9-sgRNA complexes, combined with the selection of efficient sgRNAs.…”

Section: Factors Influencing Successful Leapfroggingmentioning

confidence: 99%

“…A 'top strand' 62 nt oligo, 5′-TAATACGACTCACTATAGG-[CCTCAGAGAGGAAAAAGTAG]GTTTTAGAGCTAGAAATAGCAA-G-3′, was designed containing a T7 RNA promoter (underlined), followed by the target sequence (in brackets and without the PAM) and 23 nt of the guide backbone. A second universal bottom strand oligo of 80 nt in length, 5′-AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGA-CTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC-3′ with 23 nt overlap to the top oligo was used in the template assembly reaction as previously outlined (Nakayama et al, 2014). Following synthesis, the reaction was phenol/chloroform extracted, precipitated and resuspended in DEPC-treated H 2 O.…”

Section: Crispr/cas9 Mutagenesismentioning

confidence: 99%

“…S1). The extent of mutagenesis was assessed in these explants by direct sequencing of PCR amplicons (DSP; Nakayama et al, 2014) containing the targeted region in tyr. Sequencing traces for populations of amplicons show a mixing of peaks beginning in the vicinity of the cleavage site, providing a rough measure of mutational efficacy.…”

Section: Efficient Crispr/cas9 Mutagenesis In Pgc Transplantsmentioning

confidence: 99%

“…All embryos were subsequently cultured overnight in a 25°C incubator. Carcasses were typically homogenized in proteinase K-containing lysis buffer the following day to provide material for DSP analysis (Nakayama et al, 2014) to verify the success of CRISPR/Cas9 mutagenesis in DNA of the corresponding grafts.…”

Section: Vegetal Explants and Transplantationmentioning

confidence: 99%

See 4 more Smart Citations

Leapfrogging: primordial germ cell transplantation permits recovery of CRISPR/Cas9-induced mutations in essential genes

2016

Self Cite

View full text Add to dashboard Cite

CRISPR/Cas9 genome editing is revolutionizing genetic loss-offunction analysis but technical limitations remain that slow progress when creating mutant lines. First, in conventional genetic breeding schemes, mosaic founder animals carrying mutant alleles are outcrossed to produce F1 heterozygotes. Phenotypic analysis occurs in the F2 generation following F1 intercrosses. Thus, mutant analyses will require multi-generational studies. Second, when targeting essential genes, efficient mutagenesis of founders is often lethal, preventing the acquisition of mature animals. Reducing mutagenesis levels may improve founder survival, but results in lower, more variable rates of germline transmission. Therefore, an efficient approach to study lethal mutations would be useful. To overcome these shortfalls, we introduce 'leapfrogging', a method combining efficient CRISPR mutagenesis with transplantation of mutated primordial germ cells into a wild-type host. Tested using Xenopus tropicalis, we show that founders containing transplants transmit mutant alleles with high efficiency. F1 offspring from intercrosses between F0 animals that carry embryonic lethal alleles recapitulate loss-of-function phenotypes, circumventing an entire generation of breeding. We anticipate that leapfrogging will be transferable to other species.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Factors Influencing Successful Leapfroggingmentioning

confidence: 99%

Section: Crispr/cas9 Mutagenesismentioning

confidence: 99%

Section: Efficient Crispr/cas9 Mutagenesis In Pgc Transplantsmentioning

confidence: 99%

Section: Vegetal Explants and Transplantationmentioning

confidence: 99%

See 3 more Smart Citations

Leapfrogging: primordial germ cell transplantation permits recovery of CRISPR/Cas9-induced mutations in essential genes

2016

Self Cite

View full text Add to dashboard Cite

show abstract

Modeling ocular lens disease in Xenopus

Viet

Reboutier

Hardy

et al. 2020

Developmental Dynamics

View full text Add to dashboard Cite

Background: Ocular lens clouding is termed as cataract, which depending on the onset, is classified as congenital or age-related. Developing new cataract treatments requires new models. Thus far, Xenopus embryos have not been evaluated as a system for studying cataract. Results: We characterized the developmental process of lens formation in Xenopus laevis tailbuds and tadpoles, and we disrupted the orthologues of three mammalian cataract-linked genes in F0 by CRISPR/Cas9. We assessed the consequences of gene inactivation by combining external examination with histochemical analyses and functional vision assays. Inactivating the key metazoan eye development transcription factor gene pax6 produces a strong eye phenotype including an absence of eye tissue. Inactivating the genes for gapjunction protein and a nuclease, gja8 and dnase2b, produces lens defects that share several features of human cataracts, including impaired vision acuity, nuclei retention in lens fiber cells, and actin fibers disorganization. We tested the potential improvement of the visual acuity of gja8 crispant tadpoles upon treatment with the molecular chaperone 4-phenylbutyrate. Conclusion: Xenopus is a valuable model organism to understand the molecular pathology of congenital eye defects, including cataracts, and to screen molecules with a potential to prevent or reverse cataracts. K E Y W O R D Scataract, CRISPR, DNASE2B, GJA8, pathology, PAX6

show abstract

Cells from subcutaneous tissues contribute to scarless skin regeneration in Xenopus laevis froglets

Otsuka-Yamaguchi

Kawasumi-Kita

Kudo

et al. 2017

Developmental Dynamics

View full text Add to dashboard Cite

Cells derived from subcutaneous tissues, at least in the trunk region, contribute to and may be essential for skin regeneration. Characterizing the subcutaneous tissue-derived cells that contribute to skin regeneration in amphibians may lead to the induction of cells that can regenerate complete skin structures without scarring in mammals. Developmental Dynamics 246:585-597, 2017. © 2017 Wiley Periodicals, Inc.

show abstract

Cas9-Based Genome Editing in Xenopus tropicalis

Cited by 94 publications

References 44 publications

Leapfrogging: primordial germ cell transplantation permits recovery of CRISPR/Cas9-induced mutations in essential genes

Leapfrogging: primordial germ cell transplantation permits recovery of CRISPR/Cas9-induced mutations in essential genes

Modeling ocular lens disease in Xenopus

Cells from subcutaneous tissues contribute to scarless skin regeneration in Xenopus laevis froglets

Contact Info

Product

Resources

About