Characterization of a Putative Serk-Like Ortholog in Embryogenic Cell Suspension Cultures of Coffea arabica L.

Silva, Anderson Tadeu; Barduche, Douglas; Livramento, Kalynka Gabriella do; Ligterink, Wilco; Paiva, Luciano Vilela

doi:10.1007/s11105-013-0632-x

Cited by 27 publications

(31 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Protodermal factor 1 and SERK were targeted by miR399 (Table S10). Emergence of the protoderm has been noted as an indicator of SE (Raju et al, 2015; Zhang J. et al, 2016), and the accumulation of SERK is the most significant indication of the transition from somatic cells to embryogenic cells (Ma et al, 2012; Silva et al, 2014). According to our previous study examining SE in Lilium pumilum DC.…”

Section: Discussionmentioning

confidence: 99%

Small RNA and Transcriptome Sequencing Reveal a Potential miRNA-Mediated Interaction Network That Functions during Somatic Embryogenesis in Lilium pumilum DC. Fisch.

et al. 2017

View full text Add to dashboard Cite

Plant somatic embryos are widely used in the fields of germplasm conservation, breeding for genetic engineering and artificial seed production. MicroRNAs (miRNAs) play pivotal roles in somatic embryogenesis (SE) regulation. However, their regulatory roles during various stages of SE remain unclear. In this study, six types of embryogenic samples of Lilium pumilum DC. Fisch., including organogenic callus, embryogenic callus induced for 4 weeks, embryogenic callus induced for 6 weeks, globular embryos, torpedo embryos and cotyledon embryos, were prepared for small RNA sequencing. The results revealed a total of 2,378,760 small RNA reads, among which the most common size was 24 nt. Four hundred and fifty-two known miRNAs, belonging to more than 86 families, 57 novel miRNAs and 40 miRNA*s were identified. The 86 known miRNA families were sorted according to an alignment with their homologs across 24 land plants into the following four categories: 23 highly conserved, 4 moderately conserved, 15 less conserved and 44 species-specific miRNAs. Differentially expressed known miRNAs were identified during various stages of SE. Subsequently, the expression levels of 12 differentially expressed miRNAs and 4 targets were validated using qRT-PCR. In addition, six samples were mixed in equal amounts for transcript sequencing, and the sequencing data were used as transcripts for miRNA target prediction. A total of 66,422 unigenes with an average length of 800 bp were assembled from 56,258,974 raw reads. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment indicated that 38,004 and 15,497 unigenes were successfully assigned to GO terms and KEGG pathways, respectively. Among the unigenes, 2,182 transcripts were predicted to be targets for 396 known miRNAs. The potential targets of the identified miRNAs were mostly classified into the following GO terms: cell, binding and metabolic process. Enriched KEGG analysis demonstrated that carbohydrate metabolism was the predominant pathway in Lilium SE. Thus, we performed systemic characterization, homology comparisons and profiling of miRNA expression, and we constructed an miRNA-target network during Lilium SE for the first time. Our findings establish a foundation for the further exploration of critical genes and elucidation of SE in Lilium.

show abstract

Section: Discussionmentioning

confidence: 99%

Small RNA and Transcriptome Sequencing Reveal a Potential miRNA-Mediated Interaction Network That Functions during Somatic Embryogenesis in Lilium pumilum DC. Fisch.

et al. 2017

View full text Add to dashboard Cite

show abstract

“…(4) Somatic embryos are formed. A PeSERK signal was not observed in the somatic embryos and was instead restricted to the adjacent meristematic-like cell clusters Pérez-Nuñez et al 2009;Savona et al 2012;Steiner et al 2012;Silva et al 2014). The biological role of these different SERK homologs in embryogenesis appears to be conserved among divergent taxa of plant species.…”

Section: Discussionmentioning

confidence: 99%

“…Considerable efforts have been made to identify the relationship between the acquisition of embryogenic competence and changes in the expression of specific genes (Karami et al 2009;Yang and Zhang 2010;Savona et al 2012;Wang et al 2011;Sun et al 2012;Salvo et al 2014;Silva et al 2014;Fehér 2015). For example, the expression of the Somatic Embryogenesis Receptor-like Kinase (SERK) genes is hailed as a molecular marker of competent cells (Schmidt et al 1997;Salaj et al 2008).…”

Section: Introductionmentioning

confidence: 99%

Cellular and molecular changes associated with competence acquisition during passion fruit somatic embryogenesis: ultrastructural characterization and analysis of SERK gene expression

et al. 2015

View full text Add to dashboard Cite

The integration of cellular and molecular data is essential for understanding the mechanisms involved in the acquisition of competence by plant somatic cells and the cytological changes that underlie this process. In the present study, we investigated the dynamics and fate of Passiflora edulis Sims cotyledon explants that were committed to somatic embryogenesis by characterizing the associated ultrastructural events and analysing the expression of a putative P. edulis ortholog of the Somatic Embryogenesis Receptor-like Kinase (SERK) gene. Embryogenic calli were obtained from zygotic embryo explants cultured on Murashige and Skoog medium supplemented with 2,4-dichlorophenoxyacetic acid and 6-benzyladenine. Callus formation was initiated by the division of cells derived from the protodermal and subprotodermal cells on the abaxial side of the cotyledons. The isodiametric protodermal cells of the cotyledon explants adopted a columnar shape and became meristematic at the onset of PeSERK expression, which was not initially detected in explant cells. Therefore, we propose that these changes represent the first observable steps towards the acquisition of a competent state within this regeneration system. PeSERK expression was limited to the early stages of somatic embryogenesis; the expression of this gene was confined to proembryogenic zones and was absent in the embryos after the globular stage. Our data also demonstrated that the dynamics of the mobilization of reserve compounds correlated with the differentiation of the embryogenic callus.

show abstract

“…The PCRs containing 10 ng of cDNA template and 10 ng of primers for the gene BBM (forward primer CGAAACTTGTCACGATCCACAT and reverse primer ACCCTTGGGAAGGACTTGCT) (Silva 2011) and for the gene SERK (forward primer AAATGACCGGAGA-GACCGGAAGTT and reverse primer CTGCCCAG-CACTGCTCAA) (Silva et al 2013) occurred for 5 min at 50°C, 10 min at 95°C, followed by 40 cycles of 15 s at 95°C, 1 min at 60°C, and termination for 15 s at 95°C. The genes 14-3-3 and GAPDH were used as endogenous control to normalize the data ( Barsalobres-Cavallari et al 2009).…”

Section: Analysis Of Serk and Bbm Expression By Qpcrmentioning

confidence: 99%

Gene expression and morphological characterization of cell suspensions of Coffea arabica L. cv. Catiguá MG2 in different cultivation stages

et al. 2015

Self Cite

View full text Add to dashboard Cite

The present study aimed to evaluate the quality of cell suspension of Coffea arabica cv. Catiguá at four different ages by morphological and gene expression analysis. For this purpose, cell suspension samples were collected at 30, 45, 60 and 75 days. Morphological analysis revealed the presence of embryogenic regions in all samples, and after 60 days, non-embryogenic regions were also identified. The genic analyses revealed that as the cells were transferred to a new medium a change in both their physical and chemical conditions was noticed that caused stress. The decrease in SERK and BBM genes expression after 75th day may also be due to the non-embryogenic regions, characterized by large, elongated and vacuolated cells that were observed in the periphery of embryogenic regions, starting from 60 days of culture.

show abstract

Characterization of a Putative Serk-Like Ortholog in Embryogenic Cell Suspension Cultures of Coffea arabica L.

Cited by 27 publications

References 46 publications

Small RNA and Transcriptome Sequencing Reveal a Potential miRNA-Mediated Interaction Network That Functions during Somatic Embryogenesis in Lilium pumilum DC. Fisch.

Small RNA and Transcriptome Sequencing Reveal a Potential miRNA-Mediated Interaction Network That Functions during Somatic Embryogenesis in Lilium pumilum DC. Fisch.

Cellular and molecular changes associated with competence acquisition during passion fruit somatic embryogenesis: ultrastructural characterization and analysis of SERK gene expression

Gene expression and morphological characterization of cell suspensions of Coffea arabica L. cv. Catiguá MG2 in different cultivation stages

Contact Info

Product

Resources

About