Cloning of Proopiomelanocortin from the Brain of the African Lungfish, <i>Protopterus annectens</i>, and the Brain of the Western Spadefoot Toad, <i>Spea multiplicatus</i>

Abstract

A degenerate primer, specific for the opioid core sequence YGGFM, was used to clone and sequence proopiomelanocortin (POMC) cDNAs from the brain of the African lungfish, Protopterus annectens, and from the brain of the western spadefoot toad, Spea multiplicatus. In addition, the opioid-specific primer was used to clone and sequence a 3′RACE product corresponding to a portion of the open reading frame of S. multiplicatus proenkephalin. For both species, cDNA was made from a single brain and a degenerate opioid-specific primer provided a reliable probe for detecting opioid-related cDNAs. The African lungfish POMC cDNA was 1,168 nucleotides in length, and contained regions that are similar to tetrapod POMCs and fish POMCs. The African lungfish POMC encodes a tetrapod-like γ-MSH sequence that is flanked by sets of paired basic amino acid proteolytic cleavage sites. The γ-MSH region in ray-finned fish POMCs either has degenerate cleavage sites or is totally absent in some species. However, the African lungfish γ-MSH sequence does contain a deletion which has not been observed in tetrapod γ-MSH sequences. The β-endorphin region of lungfish POMC has the di-amino acid sequence tryptophan-aspartic acid in the N-terminal region and an additional glutamic acid residue in the C-terminal region of β-endorphin – features found in fish β-endorphin, but not tetrapod β-endorphins. The western spadefoot toad POMC was 1,186 nucleotides in length, and exhibited an organizational scheme typical for tetrapod POMCs. However, the toad POMC did lack a paired basic amino acid proteolytic cleavage site N-terminal to the β-MSH sequence. Thus, like rat POMC, it is doubtful that β-MSH is an end product in either the toad brain or intermediate pituitary. At the amino acid level, the toad POMC had 76% sequence identity with Xenopus laevis POMC and 68% sequence identity with Rana ribidunda POMC. The use of these POMC sequences to assess phylogenetic relationships within anuran amphibians will be discussed. With respect to the fragment of S. multiplicatus proenkephalin cDNA, two metenkephalin sequences and the metenkephalin-RF sequence were found encoded in this fragment. As seen for X. laevis and R. ridibunda proenkephalin, a leuenkephalin sequence was not detected in the C-terminal region of the S. multiplicatus proenkephalin. The absence of a leuenkephalin sequence may be a common feature of anuran amphibian proenkephalins.

Analyzing the evolution of the opioid/orphanin gene family

“…7; Martens, Civelli, & Herbert, 1985 . These melanocortin sequences are also found in lungfish (Amemiya et al, 1999a;Dores et al, 1999;Lee et al, 1999a), cartilaginous fish (Amemiya et al, 1999b(Amemiya et al, , 2000, and in older lineages of ray-finned fish such as the sturgeon (Amemiya et al, 1997;Alrubaian et al, 1999) and gar . A deviation from the tetrapod organizational scheme can be seen in the salmon POMC A sequence ( Fig.…”

“…However, this third predicted pentapeptide opioid site may have been retained in species of fish like the sturgeon or the lungfish. Studies on the POMC gene and the proenkephalin gene in these species suggest that the opioid genes may be evolving at a slower rate than in other gnathostome groups Lee et al, 1999a;Dores et al, 2000;Sollars et al, 2000).…”

In the African Lungfish Met-Enkephalin and Leu-Enkephalin Are Derived from Separate Genes: Cloning of a Proenkephalin cDNA

“…The remaining central region of the proenkephalin cDNA was amplified through the use of two proenkephalin-targeted primers, i.e. POMC-1024 [6](5′ AA [A/G] [A/C] GITA [C/T] GGIGGITT [C/T] ATG 3′) where I represents deoxyinosine and brackets contain mixed bases) and AFLF/PEN/R1 (5′ TGGTTATCCAGTTTCCATTCT 3′). The thermal profiles for all PCR reactions included a total of 32 cycles of denaturation at 94°C for 1 min, annealing at either 55.7°C (AFLF/PEN/F1) or 57°C (all other primers) for 1.5 min and extension at 72°C for 1.5 min (3′/5′ ends) or 2 min (central region).…”

“…The cloning and sequencing of the PCR amplification products followed the protocols used for cloning the African lungfish POMC [6]. To minimize errors due to nucleotide misincorporation by Taq DNA polymerase, the full-length sequences were constructed from a consensus of multiple overlapping clones.…”

cDNA cloning, pituitary location, and extra-pituitary expression of pro-opiomelanocortin gene in rare minnow (Gobiocypris rarus)

“…The nucleotide sequences of POMC mRNAs or POMC-like mRNAs have been found in all kinds of vertebrates, including mammals (Nakanishi et al 1979;Chang et al 1980), birds (Takeuchi et al 1999;Naudé et al 2006), reptiles (Shen et al 2003;Shoureshi et al 2007; Kobayashi et al 2007), amphibians (Martens et al 1985;Lee et al 1999), a variety of fish, including teleosts (Soma et al 1984;Salbert et al 1992;Amemiya et al 1997;Danielson et al 1999;Palermo et al 2008) and elasmobranch (Amemiya et al 2000), and jawless vertebrates such as the sea lamprey (Takahashi et al 1995). All POMC or POMC-like genes have a similar structure, and several small-molecule mature peptides such as a-melanocyte-stimulating hormone (a-MSH), b-MSH, c-MSH, adrenocorticotropic hormone (ACTH), b-endorphin (b-EP), and c-lipotropin (c-LPH) are derived from the pro-opiomelanocortin peptide by different cleavage processing pathways in different types of cells.…”