Competition of a parathion-hydrolyzing Flavobacterium with bacteria from ditch water in carbon-, nitrate- and phosphate-limited continuous cultures

Abstract

The effect of competition for macroelements with bacteria from ditch water on the parathion-hydrolyzing Flavobacterium sp. ATCC 27551 (FB) was investigated within mixed continuous cultures under carbon-, nitrate-or phosphate-limited conditions. The high initial rate of parathion hydrolysis decreased rapidly in all cultures due to the loss of strain FB. Addition of 2-isopropyl-6-methyl-4-pyrimidinol (a selective source of carbon, nitrogen and energy for FB) to one nitrate-and carbon-limited chemostat caused a 20-fold increase in parathion-hydrolyzing activity compared to unamended control cultures and retention of FB. The presence of the parathion hydrolaseencoding gene could be demonstrated by a newly developed PCR detection method in all FB cultures during most of the cultivation period. These results suggest that competition effects cause the pesticide-degrading capacity of microbial communities depending on their frequency of exposure to the pesticide compounds.

Isolation and molecular characterization of a novel <i>pseudomonas putida</i> strain capable of degrading organophosphate and aromatic compounds

“…This isolate, designated as POXN01, was determined to be a Gram-negative rod-shaped bacterium, which exhibited noticeable paraoxon-and methyl parathion-degrading activity and was capable of growing on minimal medium with paraoxon as a carbon source. 27F 16S rDNA AGAGTTTGATCMTGGCTCAG [30] U1510R 16S rDNA GGTTACCTTGTTACGACTT [31] F196 opd gene CGCGGTCCTATCACAATCTC [32] F450 opd gene CGCCACTTTCGATGCGAT [32] R757 opd gene TCAGTATCATCGCTGTGACC [32] R840 opd gene CTTCTAGACCAATCGCACTG [32] R977 opd gene TCACTCTCAGTGGAATGAAGG this study…”

“…Among OPhydrolyzing enzymes, the most studied so far is a product of opd gene, which was found in Sphingobium fuliginis [27,59], Brevundimonas diminuta GM [17,27], and in several representatives of genera Pseudomonas and Agrobacterium (in the latter case the gene is designnated opdA) [24][25][26]60]. Detection of the gene in the POXN01 strain was performed according to an established protocol that relies on analytical PCR with opdspecific primers [32]. PCR on the whole POXN01 genomic DNA yielded a single amplicon of the expected size for each of the primer pairs F196-R757, F196-R840, F450-R757, and F450-R840 (Figure 4).…”

“…Fragments of the 16S rRNA gene were amplified by PCR from cellular DNA using 16S rDNA-specific primers ( Table 1) [30][31][32] and PCR Master Mix (Promega, Madison, WI). The PCR conditions were as follows: initial denaturation at 94˚C for 4.5 min, 32 cycles consisting of denaturation at 94˚C for 0.5 min, annealing at 52˚C for 0.5 min, and extension at 72˚C for 1 min, and final elongation at 72˚C for 4 min.…”

Isolation, Molecular and Biochemical Identification of Paraoxon-Metabolizing Pseudomonas Species

“…PCR amplification of the opd gene region was conducted using series of two forward primers (F196 -CGCGGTCCTATCACAATCTC and F450 -CGCCACTTTCGATGCGAT) and two reverse primers (R757 -TCAGTATCATCGCTGTGACC and R840 -CTTCTAGACCAATCGCACTG)with PCR 2x Master Mix (Promega, Madison, WI) [23]. PCR conditions were set as follows: initial denaturation at 94˚C for 5 min, 35 cycles consisting of denaturation at 94˚C for 1 min, annealing at 55˚C for 1 min, and extension at 72˚C for 1 min, and final elongation at 72˚C for 5 min [23]. PCR products were purified using a QIAquick PCR Purification Kit (Qiagen) and checked through electrophoresis on a 1.2% agarose gel.…”

“…The degradation of these problematic compounds in both soil and aquatic environments has been tied to the presence of a rapidly growing community of bacterial microorganisms that metabolize OP compounds as sources of carbon through shared organphosphorus hydrolase (OPH) gene(s) [13,[15][16][17]. Populations of microorganisms observed to efficiently break down a range of OP pesticides include, but are not limited to, members of the genera of Burkholderia [18], Pseudomonas [14,19,20], Serratia [14], Arthrobacter [18], Enterobacter [21], Flavobacterium [22,23], and Brevundimonas (including Brevundimonas diminuta, formerly Pseudomonas diminuta) [24]. Numerous lesser known genera of soil borne bacteria have shown some propensity for OP pesticide degradation as well suggesting that these OPH genes are mobile and rapidly dispersed through microbial agricultural populations [19,25].…”