Cyclin D1 acts as a barrier to pluripotent reprogramming by promoting neural progenitor fate commitment

Chen, Chih-Lung; Wang, Liangjie; Yan, Yu-Ting; Hsu, Hua‐Yi; Su, Hong-Lin; Chang, Fang-Pei; Hsieh, Patrick C.H.; Hwang, Shiaw-Min; Shen, Chia‐Ning

doi:10.1016/j.febslet.2014.08.039

Cited by 19 publications

(65 citation statements)

References 30 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Nevertheless, Cyclin Ds have a tissue-specific expression during gastrulation (Wianny et al 1998) that resembles the pattern observed during differentiation of hESCs in vitro, suggesting that their role in the mechanisms controlling early cell fate decisions could be conserved in vivo. Cyclin D activity also promotes neuroectoderm formation during induced pluripotent stem cell generation through up-regulating Pax6 (Chen et al 2014), and, importantly, Cyclin D maintains the self-renewal of a broad number of adult stem cells, including mammary stem and progenitor cells (Jeselsohn et al 2010), neuronal stem cells (Roccio et al 2013), and hematopoietic stem cells (Lange and Calegari 2010). Therefore, the basic mechanisms uncovered by these studies could also be relevant for adult stem cells and represent an important step toward understanding the balance between differentiation and self-renewal during organ development and repair.…”

Section: Discussionmentioning

confidence: 99%

Initiation of stem cell differentiation involves cell cycle-dependent regulation of developmental genes by Cyclin D

et al. 2016

View full text Add to dashboard Cite

Coordination of differentiation and cell cycle progression represents an essential process for embryonic development and adult tissue homeostasis. These mechanisms ultimately determine the quantities of specific cell types that are generated. Despite their importance, the precise molecular interplays between cell cycle machinery and master regulators of cell fate choice remain to be fully uncovered. Here, we demonstrate that cell cycle regulators Cyclin D1-3 control cell fate decisions in human pluripotent stem cells by recruiting transcriptional corepressors and coactivator complexes onto neuroectoderm, mesoderm, and endoderm genes. This activity results in blocking the core transcriptional network necessary for endoderm specification while promoting neuroectoderm factors. The genomic location of Cyclin Ds is determined by their interactions with the transcription factors SP1 and E2Fs, which result in the assembly of cell cycle-controlled transcriptional complexes. These results reveal how the cell cycle orchestrates transcriptional networks and epigenetic modifiers to instruct cell fate decisions.

show abstract

Section: Discussionmentioning

confidence: 99%

Initiation of stem cell differentiation involves cell cycle-dependent regulation of developmental genes by Cyclin D

et al. 2016

View full text Add to dashboard Cite

show abstract

“…Recently, Pauklin et al reported that in late G1, cyclin D1 is induced and forms a complex with locus-specific transcription factors to recruit transcriptional coactivators onto neuroectoderm genes and corepressors onto endoderm genes in stem cells [52]. Importantly, it has been shown that the activities of D-type cyclins also promote neuroectoderm formation during hiPSCs generation through up-regulating Pax6 [53]. Thus, we can speculate that D-type cyclins may also influence phenotype-associated gene expression in NP.…”

Section: Discussionmentioning

confidence: 99%

Regulation of cyclin E1 expression in human pluripotent stem cells and derived neural progeny

et al. 2018

View full text Add to dashboard Cite

hPSCs: human pluripotent stem cells; hESCs: human embryonic stem cells; hiPSCs: human induced pluripotent stem cells; NP: neuroprogenitors; HF: human foreskin fibroblasts; MEFs: mouse embryonic fibroblasts; iMEFs: irradiated mouse embryonic fibroblasts; CDKs: cyclindependent kinases; CKIs: CDK inhibitors; CNS: central nervous system; Oct-4: Octamer-4; EB: embryoid body; AFP: Alpha-fetoprotein; cTnT: Cardiac Troponin T; MAP-2: microtubule-associated protein; TUJ-1: neuron-specific class III β-tubulin; bFGF: basic fibroblastic growth factor; PI3K: Phosphoinositide 3-kinase; KSR: knock out serum replacement; CM: iMEF conditioned medium; E8: Essential E8 medium.

show abstract

“…Human Abcg2 was amplified by PCR with specific primers (forward: 5′‐ACTCTCCAGATGTCTTCCAG‐3′; reversed: 5′‐TGTGAGGATAAATCATACTG‐3′) and cloned into the Nhe I and Eco RI cutting sites of lentiviral expression vector, pLKO.1‐EF1‐IRES‐m Cherry to generate pLKO.1‐EF1‐h Abcg2 ‐IRES‐mCherry expression constructs.…”

Section: Methodsmentioning

confidence: 99%

ABCG2 deficiency in skin impairs re‐epithelialization in cutaneous wound healing

Chang

Huang

Lin

et al. 2016

Experimental Dermatology

Self Cite

View full text Add to dashboard Cite

The ATP-binding cassette transporter ABCG2 is expressed in the interfollicular epidermis and mediates the side-population phenotype in skin cells. However, the role of ABCG2 in skin is unclear. Increased expression levels of ABCG2 were found at the basal layer of transitional epidermis adjacent to cutaneous wounds in human patients, indicating that ABCG2 may be involved in regulating the wound healing process. To investigate the role of ABCG2 in cutaneous wound healing, full-thickness skin wounds were created in ABCG2 knockout (ABCG2-KO) and wild-type mice. The healing process was analysed and revealed that ABCG2 deficiency in skin results in delays in wound closure and impairments in re-epithelialization, as evidenced by reductions in both suprabasal differentiation and in p63-expressing keratinocytes migrating from transitional epidermis to epithelial tongues. The reduction in p63-expressing cells may be due to elevated levels of reactive oxygen species in ABCG2-KO epidermis, which can cause DNA damage and lead to proliferation arrest. To determine whether ABCG2 deficiency affects the potency of epidermal stem/progenitor cells (EPCs), transplantation studies were carried out, which demonstrated that ABCG2-KO EPCs display higher levels of γH2AX and lose the capacity to differentiate into suprabasal keratinocytes. A competitive repopulation assay confirmed that ABCG2 expression is critical for the proper expansion and differentiation of EPCs in cutaneous wounds. As EPCs are known to contribute to the healing of larger wounds, the current findings imply a functional role for ABCG2 in the expansion and differentiation of p63-expressing EPCs. Thus, ABCG2 deficiency in skin impairs re-epithelialization in cutaneous wound healing.

show abstract

Cyclin D1 acts as a barrier to pluripotent reprogramming by promoting neural progenitor fate commitment

Cited by 19 publications

References 30 publications

Initiation of stem cell differentiation involves cell cycle-dependent regulation of developmental genes by Cyclin D

Initiation of stem cell differentiation involves cell cycle-dependent regulation of developmental genes by Cyclin D

Regulation of cyclin E1 expression in human pluripotent stem cells and derived neural progeny

ABCG2 deficiency in skin impairs re‐epithelialization in cutaneous wound healing

Contact Info

Product

Resources

About