Detection of Rat Meat Adulteration in Meat Ball Formulations Employing Real Time PCR

IkaWidyasa, Yanita; Sudjadi,; Rohman, Abdul

doi:10.3923/ajas.2015.460.465

Cited by 17 publications

(8 citation statements)

References 4 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The target primer used is mitochondrial COI-1 98470455 (forward)-98470454 (reverse), i.e., forward: 5'-CCT CAA CAT TCC CTA GGT TTAT-3'; reverse: 5'-CCT ATA GAG GAG ACG GTA TTT-3'. The designed primer was subjected to NCBI BLAST analysis in order to confirm its specificity to dog meat DNA in silico [24].…”

Section: Primer Designmentioning

confidence: 99%

“…Real-time PCR using species-specific primer has been used for analysis of non-halal meat, especially pork in food products [22], wild boar meat in meatball products [23], donkey meat and pork in raw and heatprocessed meats [21], and rat's meat DNA in meatball products [24]. Real-time PCR using some primers targeting on specific genes was also reported for the identification of dog DNA.…”

Section: ■ Introductionmentioning

confidence: 99%

See 1 more Smart Citation

The Use of Real-Time Polymerase Chain Reaction Combined with Specific-Species Primer for Analysis of Dog Meat DNA in Meatball

et al. 2020

Self Cite

View full text Add to dashboard Cite

The presence of dog meat is a crucial issue because dog meat is non-halal meat for Muslims. The objective of this study was to design and validate species-specific primer for the identification of dog meat DNA in meatball using real-time polymerase chain reaction (real-time PCR). The specific primer targeting mitochondrial cytochrome c oxidase subunit 1 (CO1) was validated. The specific primers used were designed using Integrated DNA Technologies (IDT) software and subjected to NCBI BLAST procedure. The candidate primers were tested for specificity study using several DNAs from fresh meat of pork, chicken, beef, lamb, and rat. The method was also validated by determining several parameters of linearity, sensitivity, precision, and efficiency. The results showed that primer could amplify specifically DNA target at an optimized annealing temperature of 56.6 °C. The limit of detection (LoD) obtained was 5 ng DNA, corresponding to 2.5% of dog meat in a meatball. The repeatability evaluation, expressed with relative standard deviation (RSD), and efficiency value was in the acceptable range (RSD < 25% and efficiency (90–105%). This method was successfully used for the analysis of marketed samples. Real-time PCR can be used as a standard method in halal authentication analysis through DNA analysis.

show abstract

Section: Primer Designmentioning

confidence: 99%

Section: ■ Introductionmentioning

confidence: 99%

The Use of Real-Time Polymerase Chain Reaction Combined with Specific-Species Primer for Analysis of Dog Meat DNA in Meatball

et al. 2020

Self Cite

View full text Add to dashboard Cite

show abstract

“…Fourier Transform Infrared Spectroscopy is the most commonly used technique. [11], Real-Time Polymerase Chain Reaction [12], multiplex PCR [13], and ELISA [14]. Another method that can be developed in analyzing adulteration containing animal meat, especially non-halal meat (rat meat), is to look at the fatty acid composition contained in it.…”

Section: Introductionmentioning

confidence: 99%

Authentication of Rattus Norvegicus Fat and Other Animal Fats Using Gas Chromatography-Mass Spectrometry (Gc-Ms) and Principal Component Analysis (Pca)

et al. 2023

Self Cite

View full text Add to dashboard Cite

Objective: The objective of this study was to analyze fatty acids using Gas Chromatography-Mass Spectrometry (GC-MS) in combination with chemometric Principal Component Analysis (PCA) for the authentication of Rattus norvegicus fat from other animal fats. Methods: Extraction of fat from raw meat of Rattus norvegicus, beef, chicken, pork, and dogs using the Bligh Dyer method, then derivatized with 0.2 N NaOCH3, precipitation of sodium glycerol was carried out by adding saturated NaCl to obtain methyl esters which were then injected into the GC-MS instrument. The GC-MS data were then processed using chemometric Principal Component Analysis (PCA) to group Rattus norvegicus fat with other animal fats (beef, chicken, pork, and dog). Results: The results of the study revealed that fatty acids in Rattus norvegicus using GC-MS produced eleven types of fatty acids, namely: Lauric acid (1,1%), Myristic acid (1,15%), Palmitic acid (21,12%), Palmitoleic acid (2,06%), Stearic acid (8,23%), Vaccenic acid (2,43%), Oleic acid (26,51%), Linoleic acid (19,19%), Arachidic acid (0,09%), and Eucosatrienoic acid (0,39%). Chemometrics Principal Component Analysis (PCA) of Rattus norvegicus fat allows it to be classified with other animal fats. Conclusion: The Gas Chromatography-Mass Spectrometry (GC-MS) method, in combination with chemometric Principal Component Analysis (PCA), offered effective tools for the authentication of fatty acid of Rattus norvegicus.

show abstract

“…Recently, a molecular technique has been developed in Indonesia as a rapid, sensitive, and accurate method to detect the adulteration of meat with other meats not fit for human consumption [5][6][7]. Furthermore, the polymerase chain reaction (PCR) or its generation as a specific and sensitive method has been developed by some researchers such as the amplification of 12S rRNA gene by Rodriquez et al [7], PCR-base fingerprinting technique by Saez et al [8], multiplex PCR assay by Ali et al [9], or employing real-time PCR by Widyasari et al [10].…”

Section: Introductionmentioning

confidence: 99%

Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

2020

View full text Add to dashboard Cite

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

show abstract

Detection of Rat Meat Adulteration in Meat Ball Formulations Employing Real Time PCR

Cited by 17 publications

References 4 publications

The Use of Real-Time Polymerase Chain Reaction Combined with Specific-Species Primer for Analysis of Dog Meat DNA in Meatball

The Use of Real-Time Polymerase Chain Reaction Combined with Specific-Species Primer for Analysis of Dog Meat DNA in Meatball

Authentication of Rattus Norvegicus Fat and Other Animal Fats Using Gas Chromatography-Mass Spectrometry (Gc-Ms) and Principal Component Analysis (Pca)

Sensitivity of polymerase chain reaction in the detection of rat meat adulteration of beef meatballs in Indonesia

Contact Info

Product

Resources

About