Detection of Salmonella strains in clinical samples from Saudi Arabia by invA and hilA polymerase chain reaction (PCR)-based assays

Ohud,; Al-Harthi, Maha; Eman,; Halawani, Mohamed E. El; Hayam,; Abdelkader, S Hayam

doi:10.5897/ajmr12.771

Cited by 5 publications

(2 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The Salmonellae genus was confirmed by polymerase chain reaction (PCR) using a 30-bp forward primer (F-5′CGGAACGTTATTTGCGCCATGCTGAGGTAG3′) and a 27-bp reverse primer (R-5′GCATGGATCCCCGCCGGCGAGATTGTG3′) targeting the hilA gene [ 15 ]. The Salmonella Gallinarum was confirmed by amplifying the glgC gene using the serovar specific primers (F-5′GATCTGCTGCCAGCTCAA-3′) and (R-5′GCGCCCTTTTCAAAACATA3′) as described previously [ 16 ].…”

Section: Methodsmentioning

confidence: 99%

In Vitro Characterization of Probiotic Potential of Limosilactobacillus fermentum against Salmonella Gallinarum Causing Fowl Typhoid

Mehmood

Nawaz

Rabbani

et al. 2023

Animals

View full text Add to dashboard Cite

Fowl typhoid, a septicaemic disease of poultry, is caused by Salmonella Gallinarum and leads to severe economic losses. The aim of the present study was to isolate, select and characterize indigenous probiotic lactobacilli with anti-Salmonella Gallinarum activity. A total 55 lactobacilli were isolated from the caeca and ileum parts of healthy chickens and identified to species level by 16S rDNA sequencing. All the isolates were initially screened for antimicrobial activity and selected isolates were further subjected to in vitro evaluation of probiotic properties. Lactobacilli isolates (n = 21) showed varying levels of activity (08–18 mm) against Salmonella Gallinarum. These selected isolates also showed tolerance to acidic conditions (pH 3 and 4). Out of these 21 isolates, 13 showed growth (>0.5 OD at 600 nm) 0.3% bile salts. Moreover, these isolates also had the ability of auto-aggregation (20.05 ± 0.62%–50.70 ± 1.40%), and co-aggregation with Salmonella Gallinarum (5.22 ± 0.21%–42.07 ± 0.70%). Results revealed that lactobacilli had a higher level of resistance to vancomycin (100%), streptomycin (100%), ciprofloxacin (95%), gentamicin (90%), doxycycline (90%), oxytetracycline (85%), and bacitracin (80%), and a lower level of resistance to penicillin (33%), erythromycin (28%), chloramphenicol (23%), fusidic acid (23%) and amoxicillin (4%). The Limosilactobacillus fermentum PC-10 and PC-76 were sensitive to most of the antibiotics. The overall results revealed that two Limosilactobacillus fermentum strains (PC-10 and PC-76) fulfill the in vitro selection criteria of probiotics, i.e, tolerance to low pH, resistance to bile salts, auto-aggregation, co-aggregation with Salmonella Gallinarum, and absence of acquired antibiotic resistance. The Limosilactobacillus fermentum PC-10 and PC-76 also inhibited the (>5 log10) growth of Salmonella Gallinarum in co-culture assay. It is concluded that Limosilactobacillus fermentum PC-10 and PC-76 may be further investigated and developed as anti-Salmonella Gallinarum probiotics for poultry.

show abstract

Section: Methodsmentioning

confidence: 99%

In Vitro Characterization of Probiotic Potential of Limosilactobacillus fermentum against Salmonella Gallinarum Causing Fowl Typhoid

Mehmood

Nawaz

Rabbani

et al. 2023

Animals

View full text Add to dashboard Cite

show abstract

“…Furthermore, a pre-enrichment step prior to PCR has been shown to greatly increase its sensitivity and permit earlier detection compared to culture (Daquigan, Grim, White, Hanes, & Jarvis, 2016;Mohd Afendy & Son, 2015). For PCR detection of Salmonella spp., primers to amplify the invA gene have been used successfully (Anejo-Okopi et al, 2016;Galán, Ginocchio, & Costeas, 1992;Ohud, 2012;Rizzo, 2006;Salehi, Mahzounieh, & Saeedzadeh, 2005;Sharma, 2016;Suez et al, 2013).…”

mentioning

confidence: 99%

Bacteriological quality and the prevalence of Salmonella spp. and E. coli O157:H7 in ready‐to‐eat foods from Barbados, WI

Hull-Jackson

Mota‐Meira

Adesiyun

2019

Journal of Food Safety

View full text Add to dashboard Cite

The bacteriological quality and safety of ready‐to‐eat (RTE) foods in Barbados were assessed in two separate studies conducted between 2014 and 2016. In Study 1, 206 food samples were processed for Salmonella spp. by conventional bacteriological methods. Polymerase chain reaction (PCR) and serotyping were used for confirmation. In Study 2, 120 food samples were processed for the total aerobic plate count (TAPC), coliform count, and E. coli count using conventional bacteriological methods. After a 24 hr pre‐enrichment, the food samples were screened for Salmonella spp. and E. coli O157:H7 by PCR. To validate the PCR screening method for use after pre‐enrichment, the detection limit was investigated in cooked chicken samples spiked with 10‐fold serial dilutions of an overnight culture of Salmonella Enteritidis. In Study 1, the prevalence of Salmonella Enteritidis was 1.5% (3/206). In Study 2, the prevalence of E. coli was 1.7%, and unsatisfactory TAPC (12.5%) and coliform counts (4.2%) were documented. The PCR screen detected DNA extracted from homogenates with as low as 6 CFU/mL, after a 24 hr pre‐enrichment. However, all samples screened negative (0.0%) for Salmonella spp. and E. coli O157:H7. Compared with other developing countries, the prevalence of pathogens in RTE foods in Barbados is low. Practical applications Salmonella and E.coli are major causes of food borne illness globally and antibiotic resistance among these bacteria have presented increasing challenges for clinicians. Studies demonstrate that bacterial contamination in ready‐to‐eat (RTE) foods have varied among developed and developing nations. While there are several published reports on the bacterial contamination of RTE foods from the developing Caribbean region, none have originated from Barbados. This study is the first to report a low prevalence of Salmonella, E. coli and other microbial contaminants in RTE foods sold in popular tourist districts in Barbados. This information can be applied to food safety considerations for public health and the tourism industry.

show abstract

Molecular Identification of Salmonella Strains Isolated from Livestock in Alborz Province and Their Serotyping

Moghadam

Bidhendi

Khaki

2022

Iran J Med Microbiol

View full text Add to dashboard Cite

Background and Aim: Salmonellosis is an important infectious zoonotic disease that makes it even more significant to identify and control the causative strains. Molecular methods, especially polymerase chain reaction (PCR), for virulence genes can help to quickly and accurately identify Salmonella strains. Accordingly, the purpose of this study was molecular identification based on sivH, hilA and sefA genes and serotyping of Salmonella strains isolated from livestock in Alborz province, Iran. Materials and Methods:The present study was conducted on 30 Salmonella strains isolated from livestock in Alborz province. Salmonella strains were isolated using morphological identification and differential and selective culture media. DNA was then extracted by boiling, and PCR was performed to detect the virulence genes of hilA, sivH, and sefA. The sensitivity and specificity of the primers used were determined using PCR. Results:The PCR findings showed that 27 (90%) isolates had the hilA gene, 10 (33.3%) isolates had the sefA gene, and 24 (80%) isolates had the sivH gene. Moreover, the highest frequency among serotypes was related to Salmonella typhimurium (10%). The sensitivity of ST11-ST15, hilA, sefA, and sivH primers were estimated at 0.0001, 1, 0.1, and 0.001 ng/mol, respectively. The specificity of primers for Salmonella strains was also confirmed. Conclusion:Identifying livestock with salmonellosis and isolating pathogenic strains from other livestock are of the most important methods capable of reducing the prevalence of foodborne infection in consumers. This can be achieved by the PCR technique for virulence genes, especially hilA, which is more prevalent among Salmonella strains.

show abstract

Detection of Salmonella strains in clinical samples from Saudi Arabia by invA and hilA polymerase chain reaction (PCR)-based assays

Cited by 5 publications

References 49 publications

In Vitro Characterization of Probiotic Potential of Limosilactobacillus fermentum against Salmonella Gallinarum Causing Fowl Typhoid

In Vitro Characterization of Probiotic Potential of Limosilactobacillus fermentum against Salmonella Gallinarum Causing Fowl Typhoid

Bacteriological quality and the prevalence of Salmonella spp. and E. coli O157:H7 in ready‐to‐eat foods from Barbados, WI

Molecular Identification of Salmonella Strains Isolated from Livestock in Alborz Province and Their Serotyping

Contact Info

Product

Resources

About