Development of a locus-specific, co-dominant SCAR marker for assisted-selection of the Sw-5 (Tospovirus resistance) gene cluster in a wide range of tomato accessions

Abstract

The best levels of broad-spectrum Tospovirus resistance reported in tomatoes thus far are conferred by the Sw-5 locus. This locus contains at least five paralogues (denoted Sw-5a through Sw-5e), of which Sw-5b represents the actual resistance gene. Here we evaluated a panel of seven PCR primer pairs matching different sequences within a genomic region spanning the Sw-5a and Sw-5b gene cluster. Primer efficiency evaluation was done employing tomato isolines with and without the Sw-5 locus. One primer pair produced a single and co-dominant polymorphism between susceptible and resistant isolines. Sequence analysis of these amplicons indicated that they were specific for the Sw-5 locus and their differences were due to insertions/deletions. The polymorphic SCAR amplicon encompass a conserved sequence of the promoter region of the functional Sw-5b gene, being located in the position -31 from its open reading frame. This primer pair was also evaluated in field assays and with a collection of accessions known to be either susceptible or resistant to tospoviruses. An almost complete correlation was found between resistance under greenhouse/field conditions and the presence of the marker. Therefore, this primer pair is a very useful tool in marker-assisted selection systems in a large range of tomato accessions.

Análise de fatores de resistência a Tospovirus em acessos de Solanum (secção Lycopersicon)1

“…Durante o período de 1986 a 1989, a partir do cruzamento de 'Rey de los Tempranos' com outras espé-cies de tomate, obtiveram-se linhagens que, quando submetidas à alta e baixa pressão do isolado de TSWV, apresentavam respostas diferentes, indicando segregação para o gene de resistência. Na análise de resistência realizada por Dianese et al (2010), em busca de fontes de resistência a tospovírus, o acesso 'Rey de los Tempranos' foi suscetível a isolados de GRSV. No entanto, em ensaios posteriores, esse acesso mostrou resistência específica contra isolados de TSWV.…”

“…Isso explica os maiores níveis de identidade observados entre acessos desta espécie e a fonte original do gene Sw-5b. Já 'CNPH 938' e 'CNPH 939' pertencem à espécie S. corneliomuelleri (Dianese et al 2010). Estes dois acessos também foram resistentes à espé-cie de Potyvirus denominada Pepper yellow mosaic virus (PepYMV).…”

“…Após a extração de DNA, foi realizada Polymerase Chain Reaction (PCR), para confirmar a presença da região promotora do gene de resistência Sw-5 nos diferentes acessos de tomateiro. Para tanto, foi utilizado um marcador derivado do gene Sw-5, denominado Sw-5-2 (F = 5' AATTAGGTTCTTGAAGCCCATCT 3' R = 5' TTCCGCATCAGCCAATAGTGT 3'), descrito por Dianese et al (2010).…”

“…Um dendrograma demonstrando a distância filogené-tica entre os genes/alelos foi gerado utilizando-se o método ClustalW do programa Mega 6.06 (Tamura et al 2013). (Dianese et al 2010). Corrobora essa hipótese o fato de os acessos 'PI-1123026', 'PI-1623027' e 'PI-1623028' serem, muito provavelmente, heterozigotos.…”

Development of a Single-nucleotide Polymorphism Marker for the Sw-5b Gene Conferring Disease Resistance to Tomato spotted wilt virus in Tomato

“…In particular, for TSWV resistance conferred by the Sw-5b gene, diverse molecular markers such as RAPD (random amplified polymorphic DNA), RFLP, SCAR (sequence characterized amplified regions), CAPS, and INDEL markers have been reported (Dianese et al, 2010;Garland et al, 2005;Langella et al, 2004;Roselló et al, 2001;Śmiech et al, 2000;Stevens et al, 1995). Since the successful cloning of the Sw-5b gene, a gene-based marker and two SNPs specific to the Sw-5b allele for TSWV resistance have been reported (Shi et al, 2011).…”