Development of Functional Genomic Tools in Trematodes: RNA Interference and Luciferase Reporter Gene Activity in Fasciola hepatica

Abstract

The growing availability of sequence information from diverse parasites through genomic and transcriptomic projects offer new opportunities for the identification of key mediators in the parasite–host interaction. Functional genomics approaches and methods for the manipulation of genes are essential tools for deciphering the roles of genes and to identify new intervention targets in parasites. Exciting advances in functional genomics for parasitic helminths are starting to occur, with transgene expression and RNA interference (RNAi) reported in several species of nematodes, but the area is still in its infancy in flatworms, with reports in just three species. While advancing in model organisms, there is a need to rapidly extend these technologies to other parasites responsible for several chronic diseases of humans and cattle. In order to extend these approaches to less well studied parasitic worms, we developed a test method for the presence of a viable RNAi pathway by silencing the exogenous reporter gene, firefly luciferase (fLUC). We established the method in the human blood fluke Schistosoma mansoni and then confirmed its utility in the liver fluke Fasciola hepatica. We transformed newly excysted juveniles of F. hepatica by electroporation with mRNA of fLUC and three hours later were able to detect luciferase enzyme activity, concentrated mainly in the digestive ceca. Subsequently, we tested the presence of an active RNAi pathway in F. hepatica by knocking down the exogenous luciferase activity by introduction into the transformed parasites of double-stranded RNA (dsRNA) specific for fLUC. In addition, we tested the RNAi pathway targeting an endogenous F. hepatica gene encoding leucine aminopeptidase (FhLAP), and observed a significant reduction in specific mRNA levels. In summary, these studies demonstrated the utility of RNAi targeting reporter fLUC as a reporter gene assay to establish the presence of an intact RNAi pathway in helminth parasites. These could facilitate the study of gene function and the identification of relevant targets for intervention in organisms that are by other means intractable. More specifically, these results open new perspectives for functional genomics of F. hepatica, which hopefully can lead to the development of new interventions for fascioliasis.

Reducing the future threat from (liver) fluke: realistic prospect or quixotic fantasy?

“…It has also been suggested that more complete transcriptome data will allow comparisons between flukes of different phenotypes, such as those involved in drug susceptibility and resistance (Young et al, 2010). Application of gene silencing techniques, such as RNA interference, will facilitate characterisation of gene function, and this will aid in the selection of drug targets (McGonigle et al, 2008;Rinaldi et al, 2008).…”

Suppression of Ov-grn-1 encoding granulin of Opisthorchis viverrini inhibits proliferation of biliary epithelial cells

“…An irrelevant negative control firefly luciferase ( Luc ) dsRNA derived from pGL3 was also produced (Promega, USA). Luc dsRNA was amplified using primers ds-LUC_T7-F5’- TAATACGACTCACTATAGGG TGCGCCCGCGAACGACATTTA and ds-LUC_T7-R5’- TAATACGACTCACTATAGGG GCAACCGCTTCCCCGACTTCCTTA (Rinaldi et al, 2008). The PCR products were in vitro single transcribed to produce dsRNAs and purified using the Megascript RNAi kit (Ambion, USA) accorded to the manufacturer's instructions.…”

“…This phenomenon has been co-opted in the laboratory in functional genomic approaches to analyze gene function in numerous eukaryotic species, including parasitic worms (Knox, 2012). Indeed, we successfully deployed RNAi to investigate genes in liver flukes (Rinaldi et al, 2008, Thanasuwan et al, 2014). It is notable, also, that suppression of human granulin-epithelin precursor by RNAi inhibits growth of hepatocellular carcinoma cells and shows promise as a treatment for this disease (Park et al, 2011).…”

Parasite Vaccines: Recent Progress in, and Problems Associated with their Development

“…The development of RNAi in parasites (e.g. [108][109][110][111][112]) provides the possibility of defining if a vaccine target is critical for parasite survival by specific gene-knockdown. It is really beyond the scope of this review to explore the potential and pitfalls associated with genome analysis and downstream exploitation but a general search in Pubmed (www.ncbi.nlm.nih.gov/sites/entrez) with the search string words genomes, vaccine discovery, parasite, review, will lead the reader to a number of informative review articles.…”