Dietary vitamin E, brain redox status and expression of Alzheimer's disease-relevant genes in rats

Abstract

Oxidative stress is one of the major pathological features of Alzheimer's disease (AD). Here, we investigated whether dietary vitamin E (VE) depletion may induce adverse effects and supplementation with a-tocopherol (aT) may result in beneficial effects on redox status and the regulation of genes relevant in the pathogenesis of AD in healthy rats. Three groups of eight male rats each were fed diets with deficient (, 1 mg aT equivalents/kg diet), marginal (9 mg aT equivalents/kg diet) or sufficient (18 mg aT equivalents/kg diet) concentrations of natural-source VE for 6 months; a fourth group was fed the VE-sufficient diet fortified with aT (total VE, 146 mg aT equivalents/kg diet). Feeding of the experimental diets dose dependently altered aT concentrations in the cortex and plasma. No significant changes in F 2 -isoprostane concentrations, activities of antioxidative enzymes (total superoxide dismutase, Se-dependent glutathione peroxidase) and concentrations of glutathione or the expression of AD-relevant genes were observed. In this non-AD model, depletion of VE did not induce adverse effects and supplementation of aT did not induce positive effects on the parameters related to the progression of AD.

Non-targeted1H-NMR-metabolomics suggest the induction of master regulators of energy metabolism in the liver of vitamin E-deficient rats

“…15,16 No signs of vitamin E-deficiency (ataxia) or other adverse effects were observed after 6 months in animals on the vitamin E-deficient (<1 mg kg −1 diet) or any of the other diets, 15,16 which is in agreement with previous studies. 15,16 No signs of vitamin E-deficiency (ataxia) or other adverse effects were observed after 6 months in animals on the vitamin E-deficient (<1 mg kg −1 diet) or any of the other diets, 15,16 which is in agreement with previous studies.…”

“…15,16 Briefly, 32 male Fisher 344 rats (Charles River Laboratories, Sulzfeld, Germany) with a mean initial body weight of 51 ± 5 g (mean ± SD) were randomly divided into four groups of eight animals each and fed a vitamin E-deficient (dVE; αT, <1; γT, <1; all values in mg kg −1 diet), vitamin E-marginal (mVE; αT, 6; γT, 11), vitamin E-sufficient (sVE; αT, 12; γT, 24), or vitamin E-fortified (fVE; αT, 140; γT, 24) experimental diet (ssniff Spezialdiäten GmbH, Soest, Germany) for 6 months. Other aspects of this feeding trial and details regarding the preparation of the experimental diets and animal performance were previously published.…”

Antinociceptive Action and Redox Properties of Citronellal, an Essential Oil Present in Lemongrass

“…[1][2][3][4] The presence of secondary metabolites with antioxidant activity or other redox-related properties is generally associated with such properties, as many of the conditions in which these natural products have been observed to exert a preven-tive=therapeutic action are strongly related to oxidative stress and increased reactive species production. 5,6 The increase in reactive species production may result from multiple endogenous (i.e., aging, mitochondrial metabolism) and exogenous (smoke, ultraviolet radiation, pollution) factors and induce oxidative damage to biomolecules such as DNA, proteins, and lipids.…”

Gene Expression Profiling in Cells with Enhanced γ-Secretase Activity

“…Sequence specificity was determined via nBlast. b-actin was used as housekeeping gene [82][83][84][85][86][87][88][89] for CHO as well as human cortex templates with the forward sequence: CCTTCAACACCCCAGCCATGTACG and the reverse sequence: CCTTCAACACCCCAGCCATGTACG.…”