Distribution and characterization of plasmids in oral anaerobic spirochetes

Caudry, S. D.; Klitorinos, A.; Gharbia, SE; Pssara, N.; Siboo, R.; Keng, Teresa; Chan, E. C. S.

doi:10.1111/j.1399-302x.1995.tb00111.x

Cited by 7 publications

(5 citation statements)

References 19 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Taken together, the phenotypic and genetic properties of the isolates suggest that U2a and U2b are strains of T. soeranskii while U9b and U9c are strains of T. dentieola. The presence of the same 4.2-kb plasmid in different species of Treponema reinforces the suggestion of a possible naturally occurring genetic transfer system within the periopathic treponemes (1) or their ability to take up and maintain mobilizable plasmids, especially when strains U2b and U9c were isolated from the same patient. Since this plasmid is the first one described in T. socratiskii, the designation "pTSl" is given to the 4.2kb plasmid.…”

supporting

confidence: 73%

“…The isolation of two further plasmids (7), both from T. dentieola, suggests that this species in vivo can acquire and maintain transferrable plasmids, a process that may contribute to their virulence in pedodontal disease. In a previous study, we investigated the presence of plasmids in clinical isolates of other Treponema species and determined whether such plasmids were similar to those isolated from T. dentieola (1). Screening for the presence of plasmids was carded out on nine pure strains of clinical isolates of spirochetes from pedodontal pockets.…”

mentioning

confidence: 99%

See 1 more Smart Citation

Characterization of a 4.2‐kb plasmid isolated from periodontopathic spirochetes

Chan

Klitorinos

Gharbia

et al. 1996

Oral Microbiology and Immunology

Self Cite

View full text Add to dashboard Cite

Oral anaerobic treponemes are assoicated with active periodontal disease and may comprise up to 57% of the microbiota in periodontal pockets. Four treponeme strains (designated U2a, U2b, U9b, and U9c) isolated from clincial cases were found to harbor a new 4.2-kb plasmid when plasmid DNA was extracted and purified employing the Qiagen Plasmid Kit. This plasmid differs from the smaller plasmids (2.0-, 2.6-, and 2.7-Kb) reported previously by others in Treponema denticola. The newly discovered 4.2-kb plasmid was found to be the same in all four treponeme strains by restriction endonuclease analysis. It is a circular plasmid since restriction with PstI, Pvu II, Sma I, Xma I, Ava 1 or Bam HI produced a single band of the same size. Bacterial strain U2b was shown to be Treponema socranskii and U9c to be T. denticola. The plasmid is designated "pTS1". The presence of the same plasmid in different species of the treponemes isolated from the same patient suggests the possibility of a naturally occurring genetic transfer system within the oral spirochetes or their ability to take up and maintain mobilizable plasmids.

show abstract

supporting

confidence: 73%

mentioning

confidence: 99%

Characterization of a 4.2‐kb plasmid isolated from periodontopathic spirochetes

Chan

Klitorinos

Gharbia

et al. 1996

Oral Microbiology and Immunology

Self Cite

View full text Add to dashboard Cite

show abstract

“…To prepare methylated pBFC, the plasmid was transformed into E. coli TOP10, which contains the dam gene encoding a DNA methyltransferase that methylates the N 6 position of the adenine residues in the sequence GATC (18,20). To prepare unmethylated CACTATCTAATATGAACAAAAATATAAAATATTCTC ermB cassette; F P 4 CCAGATTTTTTTTATTTCCTCCCGTTAAATAATAG ermB cassette; R P 5 GAGGAAATAAAAAAAATCTGGATTTGTGTATGT 3Ј-flanking region of TDE0911; F P 6 CACACGTAAAACAGATGAC 3Ј-flanking region of TDE0911; R P 7 CTAATCAACAAATAATACAGGTC TDE0911 probe; F P 8 CTATCTATGCTGTGCAAAATAG TDE0911probe; R P 9 CGAATGAAAAGGTACTCAACC ermB probe; F P 10 CCTCCCGTTAAATAATAG ermB probe; R P 11 CCAAATGATGCTTATGTTGC TDE0228 probe; F P 12 CCAAGTAAATTCTTGTTGCT TDE0228 probe; R P 13 CTCAGATAGTAAGGGTGT TDE1268 probe; F P 14 GGAGTTGTTGTCTTATCT TDE1268 probe; R P 15 GCACATGTAGGCTCAGCCCTGACCAAGTC aacC1 site mutagenesis; F P 16 GACTTGGTCAGGGCTGAGCCTACATGTGC aacC1site mutagenesis; R P 17 ATGTTACGCAGCAGCAACG aacC1 cassette; F P 18 TTAGGTGGCGGTACTTGGG aacC1cassette; R P 19 GAGCAACCAGAAATTGTTC 3Ј-flanking region of P 6 ; R a Underlined portions show the engineered overlapping base pairs. b Primer orientation: F, forward; R, reverse.…”

Section: Methodsmentioning

confidence: 99%

“…However, these two strains possess many physiological and genetic differences, such as serotype (7,8), oxygen tolerance (46), and biofilm formation capability (24,48,49). In addition, four plasmids have been isolated from several oral treponemes, including ATCC 33520, but none of these plasmids has been isolated from ATCC 35405 (4,5). Moreover, three shuttle vectors (pKMR4PE, pKMCou, and pBFC) that were derived from the plasmid pTS1 have been successfully transferred into ATCC 33520 but not ATCC 35405 (5,9,10,44).…”

mentioning

confidence: 99%

Disruption of a Type II Endonuclease (TDE0911) Enables Treponema denticola ATCC 35405 To Accept an Unmethylated Shuttle Vector

Bian

2011

Appl Environ Microbiol

View full text Add to dashboard Cite

The oral spirochete Treponema denticola is associated with human periodontal disease. T. denticola ATCC 35405 and ATCC 33520 are two routinely used laboratory strains. Compared to T. denticola ATCC 33520, ATCC 35405 is more virulent but less accessible to genetic manipulations. For instance, the shuttle vectors of ATCC 33520 cannot be transformed into strain ATCC 35405. The lack of a shuttle vector has been a barrier to study the biology and virulence of T. denticola ATCC 35405. In this report, we hypothesize that T. denticola ATCC 35405 may have a unique DNA restriction-modification (R-M) system that prevents it from accepting the shuttle vectors of ATCC 33520 (e.g., the shuttle plasmid pBFC). To test this hypothesis, DNA restriction digestion, PCR, and Southern blot analyses were conducted to identify the differences between the R-M systems of these two strains. DNA restriction digestion analysis of these strains showed that only the cell extract from ATCC 35405 was able to digest pBFC. Consistently, PCR and Southern blot analyses revealed that the genome of T. denticola ATCC 35405 encodes three type II endonucleases that are absent in ATCC 33520. Among these three endonucleases, TDE0911 was predicted to cleave unmethylated double-stranded DNA and to be most likely responsible for the cleavage of unmethylated pBFC. In agreement with this prediction, the mutant of TDE0911 failed to cleave unmethylated pBFC plasmid, and it could accept the unmethylated shuttle vector. The study described here provides us with a new tool and strategy to genetically manipulate T. denticola, in particular ATCC 35405, and other strains that may carry similar endonucleases.More than 80% of the adult population at some time in their lives suffers from periodontal disease, which is primarily caused by polymicrobial infections (11, 37). More than 700 different microorganisms have been suggested to colonize the oral flora (13,27,36). A body of studies has shown that the presence and burden of oral spirochetes is associated with the severity of periodontal disease (16,36,42). In the oral flora, more than 60 different spirochete species have been identified, and they all belong to the genus Treponema (13, 36). Due to their fastidious growth requirements, very few oral treponemes can be reliably cultivated (6, 16). Treponema denticola, an oral spirochete that can be readily cultured, has been used as a model bacterium to study the biology and virulence of oral treponemes because its genome has been sequenced and it can be genetically manipulated (16,23,25,28,43,50).T. denticola ATCC 35405 and ATCC 33520 are two genetically related reference strains that are often used to study the genetics and virulence of spirochetes (17,21,25). T. denticola ATCC 33520 shares more than 76% DNA similarity with ATCC 35405 (7). However, these two strains possess many physiological and genetic differences, such as serotype (7, 8), oxygen tolerance (46), and biofilm formation capability (24,48,49). In addition, four plasmids have been isolated from several oral...

show abstract

“…We compared the 3 plasmids of T. denticola by size, restriction mapping, regions of homology, and presence of ssDNA. Recently, Caudry et al (5) have reported a 2.6-kb pTDl-like plasmid in 77 denticola clinical isolate e'.…”

mentioning

confidence: 99%

Homology among Treponema denticola plasmids

Reedy¹,

Simonson²,

Zablen³

1994

Oral Microbiology and Immunology

View full text Add to dashboard Cite

Three of 16 isolates of Treponema denticola were found to contain small (2.0-2.7 kb) cryptic plasmids. These were pTD1 from T. denticola ATCC 33520, pTD2 from strain T32A, and pTD3 from strain D3A1. These plasmids were characterized by restriction mapping and cloned into E. coli plasmid pUC19. Extensive homology between these plasmids was revealed by Southern blot, and single-stranded DNA regions were found by neutral Southern blots and S1 nuclease mapping. These plasmids were not found in serovars usually associated with human periodontal disease nor are they universal in all T. denticola strains and serovars.

show abstract

Distribution and characterization of plasmids in oral anaerobic spirochetes

Cited by 7 publications

References 19 publications

Characterization of a 4.2‐kb plasmid isolated from periodontopathic spirochetes

Characterization of a 4.2‐kb plasmid isolated from periodontopathic spirochetes

Disruption of a Type II Endonuclease (TDE0911) Enables Treponema denticola ATCC 35405 To Accept an Unmethylated Shuttle Vector

Homology among Treponema denticola plasmids

Contact Info

Product

Resources

About