Endotoxin at low doses stimulates pituitary GH whereas it decreases IGF-I and IGF-binding protein-3 in rats

Abstract

While it is well known that sepsis inhibits serum IGF-I and its gene expression in the liver, the effect on pituitary GH and IGF-binding protein-3 (IGFBP-3) is poorly understood. The GH-IGF-I-IGFBP-3 response to different doses of lipopolysaccharide (LPS) administration has been investigated in adult male rats. Two experiments were performed, administration of low doses of LPS (5, 10, 50 and 100 µg/kg) and high doses of LPS (100, 250, 500 and 1000 µg/kg). Rats received two i.p. injections of LPS (at 1730 h and 0830 h the following day) and were killed 4 h after the second injection. LPS administration induced a biphasic response in serum concentrations of GH, with an increase at the 10 µg/kg dose, followed by a decrease at higher doses (100 µg/kg on up). Pituitary GH mRNA was also increased by the administration of 10 and 50 µg/kg LPS, whereas at higher doses LPS did not modify pituitary GH mRNA. We also analyzed the GH response to LPS in primary pituitary cell cultures. When exposed to LPS, in the culture medium, there was an increase in GH release at the concentration of 0·1 and 10 ng/ml, whereas more concentrated LPS did not modify GH release. Serum concentrations of IGF-I declined in a dose-dependent fashion after LPS administration in the rats injected with 10 µg/kg LPS on up. This decrease is secondary to modifications in its synthesis in the liver, since endotoxin injection decreased both IGF-I and its mRNA in the liver. The liver GH receptor mRNA was also decreased by LPS administration, but only in the animals injected with high LPS doses. There was a decrease in both the IGFBP-3 serum levels and its gene expression in the liver with all LPS doses studied. These data suggest a biphasic LPS effect on pituitary GH, a stimulatory effect at low doses and an inhibitory effect at higher doses, whereas it has a clear inhibitory effect on IGF-I and IGFBP-3 synthesis in the liver. The decrease in liver IGFBP-3 mRNA and in serum concentrations of IGFBP-3 in the rats injected with LPS may contribute to the decrease in serum concentrations of IGF-I.

Inactivation of Kupffer cells by gadolinium administration prevents lipopolysaccharide-induced decrease in liver insulin-like growth factor-I and IGF-binding protein-3 gene expression

“…In addition, cytokines and LPS are able to inhibit GHR and IGF-I gene expression both in vitro and in vivo (Wof et al 1996, Defalque et al 1999, suggesting that LPS induces GH resistance. Furthermore, LPS, at low doses, decreases liver IGF-I and IGFBP-3 gene expression in rats, whereas it stimulates GH secretion (Priego et al 2003b). All these data indicate that one of the mechanisms by which LPS injection inhibits hepatic GHR, IGF-I and IGFBP-3 gene expression is by acting directly on the liver.…”

“…LPS-induced decrease in serum concentrations of IGF-I and IGFBP-3 is due to a direct inhibitory effect of LPS on liver IGF-I and IGFBP-3 gene expression, regardless of pituitary GH secretion (Defalque et al 1999, Priego et al 2003b. Induction of inducible nitric oxide synthase (iNOS) during sepsis is involved in the inhibition of IGF-I-IGFBP-3 after LPS administration (Priego et al 2004).…”

Liver transduction with a simian virus 40 vector encoding insulin-like growth factor I reduces hepatic damage and the development of liver cirrhosis

“…IGFBP3 concentration was determined in total rat serum by Western blot analysis 38 developed with 125 I-labelled rat IGF-I (DSL) Oligo sequences, annealing temperatures (Tm) and elongation times at 721C are indicated. GADPH GATGGTGAAGGTCGGTGTG CTTCCACGATGCCAAAGTTG 3 68 87 IGF-I TTCAGTTCGTGTGTGGACCAAGG GAAGTCCCAGCCCCTATCGACAC 2 63 87 IGFBP3 CCTCCGAGTCTAAGCGGGAGAC GCATTGCCTCAGCGTGCAGAG 2 63 86 HGF AGGGAATCCTCTCGTTCCTTGG GAGGCGAGGCGAAACGCAAAC 3 62 83 Abbreviations: GADPH, glyceraldehyde-3-phosphate dehydrogenase; HGF, hepatocyte growth factor; IGF-I, insulin-like growth factor-I; IGFBP3, IGF-binding protein 3; PCR, polymerase chain reaction.…”

Dexamethasone administration attenuates the inhibitory effect of lipopolysaccharide on IGF-I and IGF-binding protein-3 in adult rats

“…Forty rats were injected intraperitoneally with LPS (250 µg/kg) or saline at 1800 h on one day and at 1000 h on the following day. Rats were killed by decapitation 3 h after the second LPS or saline injection, between 1300 h and 1345 h. This LPS administration protocol has been shown to decrease levels of serum IGF-I and its mRNA in the liver (Priego et al 2003a). In order to study if glucocorticoid administration is able to prevent the effect of LPS on IGF-I, rats were pretreated with dexamethasone.…”

“…LPS administration decreases circulating levels of IGF-I both in humans and in experimental animals (Fan et al 1994, Soto et al 1998. We have previously observed that the decrease in serum IGF-I is associated with a decrease in growth hormone (GH) receptor and IGF-I synthesis in the liver (Priego et al 2002a(Priego et al , 2003a.…”