Enhancement of glucose oxidase production in batch cultivation of recombinant Saccharomyces cerevisiae: optimization of oxygen transfer condition

Abstract

Aims: To obtain an optimal combination of agitation speed and aeration rate for maximization of speci®c glucose oxidase (GOD) production in recombinant Saccharomyces cerevisiae, and to establish a correlation between k L a vis-a Á-vis oxygen transfer condition and speci®c glucose oxidase production. Methods and Results: The oxygen transfer condition was manifested indirectly by manipulating the impeller speed and aeration rate in accordance with a Central Composite Rotatory Design (CCRD). The dissolved oxygen concentration and the volumetric oxygen transfer coef®cient (k L a) 1 were determined at corresponding combinations of impeller speed and aeration rate. The maximal speci®c extracellular glucose oxidase production (3á17 U mg ±1 dry cell mass) was achieved when the initial dissolved oxygen concentration was 6á83 mg l ±1 at the impeller speed of 420 rev min ±1 and at the rate of aeration of 0á25 vvm. It was found out that while impeller speed had a direct effect on the production of enzyme, a correlation between k L a and speci®c GOD production could not be established. Conclusions: At the agitation speed of 420 rev min ±1 and at 0á25 vvm aeration rate, the degree of turbulence and the dissolved oxygen concentration were thought to be optimal both for cellular growth and production of enzyme. Signi®cance and Impact of the Study: The combined effect of agitation and aeration on recombinant glucose oxidase production in batch cultivation has not yet been reported in the literature. Therefore, this study gives an insight into the effect of these two important physical parameters on recombinant protein production. It also suggests that since there is no correlation between k L a and speci®c production of GOD, k L a should not be used as one of the scale-up parameters.

The Reinforcing Effect of Combined Carbon Nanotubes and Acetylene Blacks on the Positive Electrode of Lithium‐Ion Batteries

“…The CMCase‐expression vector, pGK–CMCF was constructed by subcloning the killer toxin signal sequence of Kluyveromyces lactis and the PCR‐amplified CMCase gene of B. subtilis with primer pairs CMCN (5′‐CCCGGGACAAAAACGCCAGTAGCC‐3′) and CMCF (5′‐GGATCCATCTTTGGTGCCGAGAATG‐3′) from the pBS1 plasmid (Park et al , 1991) into the Eco RI– Hin dIII site of pDLGPD‐Hir (Figure 1). For construction of the GOD‐expression cassette, the 1.8 kb GOD gene and the α‐amylase signal sequence were first obtained by PCR from the pGAL–GO2 containing the GOD gene of A. niger (Kapat et al , 2001) and the α‐amylase secretion signal sequence of A. oryzae (Wirsel et al , 1989). The primer pairs GODN (5′‐GCTCTTCTAGCAATGGCATTGAAGCCAG‐3′) and GODC (5′‐CTCGAGAAGCTTCTAGATCACTGCATGGAAGCATAA‐3′) were used for the GOD gene and amy1 (5′‐CGAATTCAAAAATGGTCGCGTGGTGGTGGTCTC‐3′) andamy2 (5′‐TGGCGCCGGCCAAAGCAGGTGCCGCGAC‐3′) were used for the α‐amylase secretion signal sequence.…”

Anaerobic and aerobic continuous cultures of Saccharomyces cerevisiae : comparison of plasmid stability and EXG1 gene expression

“…Moreover, the effect of oxygen concentration on the expression and stability of the recombinant enzyme has also to be considered. Thus, an optimal value can increase gene expression [10], and on the other side, a high oxygen pressure or rapid increases in oxygen content can cause oxidative stress leading to oxidation of recombinant proteins [11]. EXG expression in the wild S. cerevisiae strain has been considered as growth associated [12,13].…”

Improvement Strategies, Cost Effective Production, and Potential Applications of Fungal Glucose Oxidase (GOD): Current Updates

“…Further, expression and optimization of GOD production have been achieved through the application of recombinant DNA technology in fungi other than their native sources to overcome these difficulties. Cloning and overexpression of GOD in Saccharomyces cerevisiae, Escherichia coli , and other fungal hosts from Aspergillus and Penicillium species have been successfully carried out (Park et al, 2000; Kapat et al, 2001; Malherbe et al, 2003; Shaikh and Trivedi, 2016). Witt et al (1998) cloned and expressed the gene encoding P. amagasakiense GOD in E. coli .…”