Eukaryotic Translation Elongation Factor 1 Delta Inhibits the Nuclear Import of the Nucleoprotein and PA-PB1 Heterodimer of Influenza A Virus

Abstract

The viral ribonucleoprotein (vRNP) of the influenza A virus (IAV) is responsible for the viral RNA transcription and replication in the nucleus and its functions rely on host factors. Previous study has indicated that eukaryotic translation elongation factor 1 delta (eEF1D) may associate with RNP subunits, but its roles in IAV replication are unclear. Herein, we showed that eEF1D was an inhibitor of IAV replication, because knockout of eEF1D resulted in a significant increase in virus yield. eEF1D interacted with RNP subunits PA, PB1, PB2, and also with NP in an RNA-dependent manner. Further studies revealed that eEF1D impeded the nuclear import of NP and PA-PB1 heterodimer of IAV, thereby suppressing the vRNP assembly, viral polymerase activity, and viral RNA synthesis. Together, our studies demonstrate eEF1D negatively regulating the IAV replication by inhibition of the nuclear import of RNP subunits, which not only uncovers a novel role of eEF1D in IAV replication but also provides new insights into the mechanisms of nuclear import of vRNP proteins. IMPORTANCE Influenza A virus is the major cause of influenza, a respiratory disease in humans and animals. Different from most other RNA viruses, the transcription and replication of IAV occur in the cell nucleus. Therefore, the vRNPs must be imported into the nucleus for viral transcription and replication, which requires participation of host proteins. However, the mechanisms of the IAV-host interactions involved in nuclear import remain poorly understood. Here, we identified eEF1D as a novel inhibitor for the influenza virus life cycle. Importantly, eEF1D impaired the interaction between NP and importin α5 and the interaction between PB1 and RanBP5, which impeded the nuclear import of vRNP. Our studies not only reveal the molecular mechanisms of the nuclear import of IAV vRNP, but also provide potential anti-influenza targets for antiviral development.

CMAS and ST3GAL4 Play an Important Role in the Adsorption of Influenza Virus by Affecting the Synthesis of Sialic Acid Receptors

“…The single-guide RNA (sgRNA) sequence targeting the swine CMAS gene (5′- CACCGAGAACATTAAGCACCTGGCGGGG -3′) or ST3GAL4 gene (5′- CACCGTTCAGGGTAGAAGAGACGCATGG -3′) were cloned into LentiGuide-Puro vector to produce the recombined lentivirus. The NPTr-Cas9 cells were infected with the CMAS or ST3GAL4 LentiGuide-Puro lentivirus, and puromycin (2.5 μg/mL) was added to select the positive cells at 24 h post-infection (hpi) [ 39 ]. Then, the knockout efficiency of sgRNA was confirmed by sequencing at the genome level.…”

“…The colorimetric-based cell counting kit-8 (CCK-8) assay (Dojindo Molecular Technologies, Rockville, MD, USA) was used to determine cell viability [ 39 ]. In short, control and KO cells were seeded in 96-well plates, and then 10 μL of CCK-8 reagent was added to each well at 12, 24 and 36 h. The plates were incubated in a 37 °C constant temperature incubator for 4 h and the absorbance at 450 nm was measured with a microplate reader [ 39 ].…”

Construction, Identification and Analysis of the Interaction Network of African Swine Fever Virus MGF360-9L with Host Proteins

“…Also, many viruses, including foot-and-mouth disease virus (FMDV), strictly depend on the host–cell translation system to reproduce [ 40 ]. However, host cells also synthesize antiviral proteins to limit viral replication; for example, tripartite motif-containing 35 and eukaryotic translation elongation factor 1 delta can inhibit the replication of influenza A virus [ 41 , 42 ]. Viruses can participate in host cells’ biological processes through interaction with host proteins, therefore changing the microenvironment of host cells, inhibiting the synthesis of host proteins, and releasing cell resources to optimize their replication and transmission.…”

Mammalian and Avian Host Cell Influenza A Restriction Factors

“…Eukaryotic translation elongation factor 1 delta (eEF1D) is a subunit of the eEF1 complex, which is involved in translation elongation and other non-canonical processes. eEF1D knock-out has been shown to improve IAV replication (by 1 log) and, conversely, its overexpression caused a decrease in replication (by 1 log) [ 374 ]. This has been linked to an interaction between eEF1D and vRNP components, leading to a decrease in nuclear import, rather than its effect on viral translation as could have been expected [ 374 , 375 ].…”