Evaluation of different DNA extraction methods for the detection of adulteration in raw and processed meat through polymerase chain reaction—restriction fragment length polymorphism (PCR-RFLP)

Muhammed, Majeed; Bindu, B. Sri Charan; Jini, R.; Prashanth, K. V. Harish; Bhaskar, N.

doi:10.1007/s13197-013-1024-9

Cited by 16 publications

(11 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…These values meet criteria of linearity curve, while the amplification efficiency at 74.5% exceeds the criteria in Bio-Rad (2006), namely 90-110%. The low efficiency values can be caused by lack of pipetting precision and DNA extraction methods (Muhammed et al, 2015). , using isolate DNA from fresh rat tissue…”

Section: Resultsmentioning

confidence: 99%

Detection of Rat Meat Adulteration in Meat Ball Formulations Employing Real Time PCR

IkaWidyasa¹,

Sudjadi²,

Rohman³

2015

Asian J. of Animal Sciences

View full text Add to dashboard Cite

Rat meat is not halal for Muslims, so that the presence of rat meat in any food is a crucial issue. The aim of this study was to design specific primer from Mitochondrial Cty b Rattus argentiventer that can be used for determining rat meat contamination or rat meat adulteration in meatball formulation using, Real Time Polymerase Chain Reaction (RT-PCR). The specificity of primers was confirmed in fresh tissue from pigs, cows, chickens, goats, rabbits and white mice. The designed primers were then used to analyze rat meat DNA in meatball formulation made from rat meat and beef mixture at 1, 2, 3, 5, 10, 25, 50 and 100% incorporation of rat meat. The repeatability test was performed by measuring the amplification from fresh rat tissue and rat meat in meatball. Primers were also subjected to sensitivity test of 6 dilution series (50000, 5000, 500, 50, 5 and 0.5 pg μLG 1 ) of rat tissue. From two primers designed, primers cytb 42 (forward: 5'-TAA CCA CTC CTT CAT CGA CCT T-3'; reverse: 5'-CCC CGT TGG CGT GTA AAT A-3') were more specific to evaluate the presence of rat meat in fresh tissue and in meatball formulation at optimum annealing temperature of 61.4°C. The primers can be used for DNA identification by RT-PCR with sensitivity expressed by limit of detection of 5 pg or in meatball formulation at concentration of 1% rat meat.

show abstract

Section: Resultsmentioning

confidence: 99%

Detection of Rat Meat Adulteration in Meat Ball Formulations Employing Real Time PCR

IkaWidyasa¹,

Sudjadi²,

Rohman³

2015

Asian J. of Animal Sciences

View full text Add to dashboard Cite

show abstract

“…The R 2 obtained is 0.910 and E = 64.0%. The low value of E can be caused by lack of pipetting precision and DNA extraction methods (Muhammed et al, 2015). Repeatability test demonstrated the amplification of all positive response samples containing porcine DNA in serial dilution (10000-1 pg).…”

Section: Resultsmentioning

confidence: 99%

Real-Time Polymerase Chain Reaction for Halal Authentication of Gelatin in Soft Candy

Sepminarti¹,

Sudjadi²,

Wardani³

et al. 2015

Asian J. of Biochemistry

View full text Add to dashboard Cite

Currently, along with the development of science and technology, the diversification of food products occurs in the market. Food products can contain non-halal components like porcine gelatine. One of food suspected to use gelatine is soft candy. Gelatin can be made from pork or beef or other animal. The presence of porcine gelatine in any food products is not allowed for Moslem community, therefore an analytical method offering reliable results must be developed. This study is intended to use Real-Time Polymerase Chain Reaction (RT-PCR) for analysis of porcine gelatine in soft candy. Isolation of DNA was performed with mitochondrial DNA Isolation Kit K280-50 (Bio-Vision). The DNA was analyzed by RT-PCR using primer D-Loop 318. Analysis for the primer specificity was performed on fresh tissue (pig, cows, chickens, goats and rats) and gelatin sources (beef, pigs and catfish). Primer D-loop318 can amplify porcine DNA at the optimum temperature 61.4°C. Repeatability test demonstrated amplification of all positive response samples containing porcine DNA in serial dilution of 10000-1 pg). The Coefficient of Variation (CV) is 6.32%. The repeatability test was also performed on soft candy 100% having CV of 1.06%. The commercial soft candy samples evaluated do not contain porcine DNA.

show abstract

“…If amplification efficiency values are higher than 100%, the thermocycling conditions and the reactions occurring in PCR components are less than optimal (Life Technologies, 2012). Efficiency values can be influenced by several factors, namely the presence of inhibitors in the master mix PCR, the purity of the reagents used, inconsistencies in the small volume piping process-which results in low accuracy, and the testing ability that depends on the primer specificity and target sequence length of the printed DNA (Svec et al, 2015;Muhammed et al, 2015). Extremely high efficiency indicates that the target DNA duplicated in each cycle is disturbed by the presence of an inhibitor during the reaction, whereas too small efficiency values represent imperfect primer attachment.…”

Section: Resultsmentioning

confidence: 99%

Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B

Salamah

Erwanto²,

Martono³

et al. 2019

Pharmaciana

View full text Add to dashboard Cite

The design of specific primers is an interesting research topic such that it offers selective, specific, and effective DNA analysis using real-time PCR. This research was intended to detect bovine DNA using real-time PCR and specific primers to ensure the halal authenticity of food products. Primers of bovine DNA sequences were designed in the NCBI and Primer-BLAST programs. The outcome validation was assessed using several parameters, namely specificity, repeatability, and linearity by real-time PCR. Primer specificity test was performed on fresh tissue (pork and negative control), while the repeatability test used six replications and was based on the calculated coefficient of variation (CV). In the linearity test, six different DNA concentrations (50000, 10000, 5000, 500, 100, and 50 pg/µL) were examined to obtain the efficiency value. Using the specific primer from Cytochrome-B, the real-time PCR could specifically identify the presence of bovine DNA at the optimum annealing temperature of 58.7 0 C. The repeatability analysis yielded a coefficient of variation (CV) of 0.57 %, while the linearity test produced an efficiency value of 206 %. These figures confirm that the method employed in this study is not only specific but also sensitive and reliable for detecting bovine DNA. Real-time PCR using specific primer targeting on the cytochrome-B region of bovine DNA (forward: CTACTGACACTCACATGAATTGG; reverse CACTAGGATGAGGAGAAAGTATAGG) can be used to identify bovine DNA and distinguish it from porcine DNA.

show abstract

Evaluation of different DNA extraction methods for the detection of adulteration in raw and processed meat through polymerase chain reaction—restriction fragment length polymorphism (PCR-RFLP)

Cited by 16 publications

References 15 publications

Detection of Rat Meat Adulteration in Meat Ball Formulations Employing Real Time PCR

Detection of Rat Meat Adulteration in Meat Ball Formulations Employing Real Time PCR

Real-Time Polymerase Chain Reaction for Halal Authentication of Gelatin in Soft Candy

Real-Time PCR-based detection of bovine DNA by specific targeting on cytochrome-B

Contact Info

Product

Resources

About