Exploration of the exonic variations of the iPSC-related <i>Nanog</i> gene and their effects on phenotypic traits in cattle

Abstract

Abstract. Nanog is an important pluripotent transcription regulator transforming somatic cells to induced pluripotent stem cells (iPSCs), and its overexpression leads to a high expression of the growth and differentiation factor 3 (GDF3), which affects animal growth traits. Therefore, the aim of this study was to explore the genetic variations within the Nanog gene and their effects on phenotypic traits in cattle. Six novel exonic single nucleotide polymorphisms (SNPs) were found in six cattle breeds. Seven haplotypes were analyzed: TCAACC (0.260), TCAATA (0.039), TCATCC (0.019), TCGACC (0.506), TCGATA (0.137), TCGTCC (0.036), and CT-GATA (0.003). There were strong linkage disequilibriums of SNP1 and SNP2 in Jiaxian cattle as well as of SNP5 and SNP6 in both Jiaxian cattle and Nanyang cattle. Moreover, SNP3, SNP4, and SNP5 were associated with phenotypes. The individuals with GG genotype at the SNP3 locus or AA genotype at the SNP4 locus showed better body slanting length and chest circumference or body height and hucklebone width in Nanyang cattle. The superiority of the SNP5-C allele regarding body height and cannon circumference was observed in Jiaxian cattle. The combination of SNP3 and SNP4 (GG-AA) had positive effects on body height, body slanting length, and chest circumference. These findings may indicate that Nanog, as a regulator of bovine growth traits, could be a candidate gene for marker-assisted selection (MAS) in breeding and genetics in cattle.

A novel 29 bp insertion/deletion (indel) variant of the <i>LHX3</i> gene and its influence on growth traits in four sheep breeds of various fecundity

“…It is very important to have great knowledge of the gene structure and function for regulation of growth and development. Recent studies have focused on genetic variations within the LHX3 gene in bovines and goats, among which a number of SNP sites were found which could impact growth and milk traits (Jing et al, 2008;Liu et al, 2011;Jin et al, 2016;Zhang et al, 2016). Herein, we firstly confirmed a novel 29 bp indel (NC_019460:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the intron of the sheep LHX3 gene in four indigenous sheep breeds.…”

Identification of a novel 24 bp insertion–deletion (indel) of the androgen receptor gene and its association with growth traits in four indigenous cattle breeds

“…The chi-square test between varieties and ANOVA in varieties was conducted using SPSS software (version 18.0; International Business Machines, US) The results were subjected to statistical testing (P < 0.05; Pan et al, 2013;Zhang et al, 2016).…”