First Report of Tagetes erecta Damping Off Caused by Ceratobasidium sp. from India

Abstract

The Mexican marigold (Tagetes erecta) is cultivated commercially in India for medicinal, ceremonial, and decorative purposes. It is native to Mexico and the United States. The natural phytochemical thiophene extracted from T. erecta has been shown to have antibacterial activity. It is also grown to extract lutein, a common yellow/orange food color. During winter of 2011, approximately 15% marigold seedlings exhibited damping off symptoms at CSIR-CIMAP, Lucknow, India, and its adjoining areas. Infected seedlings initially produced water-soaked lesions on the stem at the soil level that later turned pinkish with a brownish halo in the center. The infected seedlings were cut into small pieces, surface disinfected with 1% sodium hypochlorite, rinsed thrice with sterile distilled water, and placed onto potato dextrose agar (PDA) plates. The plates were incubated at 25°C for 3 days. The isolation yielded whitish fungal growth that later turned tan brown. The mycelium was binucleate, septate, sub branching at right angles, with distinct constriction at the origin of branching. Bisbenzamide (Hoechst 33258; Chemical Abstracts no. 23491-45-4) was used as fluorescent dye for the staining of nuclei. Based on cultural as well as morphological characteristic features, the fungus was identified as Ceratobasidium sp. (1,2). The molecular identification was on the basis of internal transcribed spacer (ITS) region sequence. Amplification of the ITS of rDNA using primers ITS1/ITS4 yielded a ~700 bp band and sequenced data were deposited in the NCBI GenBank (KC193238). The ITS region (700 bp) was 100% identical to Ceratobasidium sp. AG-F strain BAGF101 isolated from Musa spp. in Georgia, United States (GenBank Accession No. HQ168370). The pathogenicity of the fungus was tested under glasshouse conditions. The inoculum of the fungus was prepared on sterile maize seeds in Erlenmeyer flasks by inoculating seeds with three disks (1 mm) of 5-day-old culture, and kept at 25 ± 2 °C for 14 days in the dark. The healthy, 5 to 7 day old seedlings were inoculated with five artificially infested maize seeds per pot. The uninoculated seedlings served as control. Both inoculated and uninoculated seedlings were kept at 28 ± 2°C in a humidity (95%) chamber for 3 days and thereafter placed in the glasshouse at 28 ± 2°C for development of disease symptoms. Initial symptoms developed as water-soaked lesions on the infected seedlings in 2 to 3 days, while typical disease symptoms appeared after 4 to 5 days of inoculation. Uninoculated seedlings were free from infection. The fungus was reisolated from the artificially infected seedlings on PDA and its identification as Ceratobasidium sp. was confirmed by morphological and molecular characteristics. Recently, Ceratobasidium sp. was reported as causal organism of root rot on Atractylodes macrocephala and banana (3,4). To the best of our knowledge, marigold damping off disease caused by Ceratobasidium sp. has not been reported so far on T. erecta. Hence, it is the first report from India. During fungal disease management for marigold, association of Ceratobasidium sp. should not be ignored for better crop protection. References: (1) R. T. Moore. Mycotaxon 29:91, 1987. (2) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN. 1991. (3) J. Yin et al. Plant Dis. 95:490, 2011. (4) J. M. You et al. Plant Dis.97:139, 2013.

Análisis filogenético multilocus del complejo fúngico asociado a pudrición radicular de sandía en Sonora, México

“…encontrados en esta investigación pertenecen al grupo AG-F, lo que coincide con trabajos previos sobre pudrición radicular en sandía realizados en Arizona, EUA (Nischwitz et al, 2013) e Italia (Aiello et al, 2012). Ceratobasidium AG-F también es el agente causal de pudrición radicular en fresa (Sharon et al, 2007), Tagetes erecta (Saroj et al, 2013) y pistache (Alaei et al, 2017).…”

Antifungal action of Lippia alba essential oil in Rhizoctonia solani disease management

“…The infected plant parts were cut into small pieces; surface sterilized with 1% sodium hypochlorite, rinsed thrice with sterile distilled water and placed onto the Potato Dextrose Agar (PDA) plates. The plates were incubated at 25 ± 2 °C for 3 days [17]. The isolation yielded fungal colony from all plant samples.…”

“…DNA extraction procedure accorded to the instructions which was given in the kit user's manual DNeasy Plant Mini Kit (Qiagen/NucleoSpin ® DNA extraction Kit Macherey-Nagel, Düren, Germany). The extracted DNA pellet was kept at − 20° C. Two primers [ITS-1 (TCC GTA GGT GAA CCT GCG G) (Qiagen) and ITS-4 TCC TCC GCT TAT TGA TAT GC) (Qiagen)] were used for the PCR amplification of the DNA region encoding 18S, ITS-1, 5.8S, ITS-2 and 28S rDNA [17]. Amplification was carried out in a 25 μl PCR reaction mixture containing 2.5 μl Taq buffer, 1 μl dNTP, 0.8 μl primers IST1-forward and ITS4-reverse, 3 μl fungal genomic DNA, 0.5 μl Taq DNA polymerase and 16.4 μl mili-q water.…”

“…Pathogenicity test of each isolates (Oci Rh-1 and Pl Rh-1) was carried out on their respective host plants in separate experiments to confirm Koch's postulate. The inoculum of the fungus was prepared on sterile maize seeds in Erlenmeyer flask by inoculating seeds with 3 discs (1 mm) of 7 days old culture and kept at 27 ± 2 °C for 14 days in dark condition [17]. The healthy, 7-10 days old plants were inoculated with 5 artificially infested maize seeds per pot.…”

Anti-phytopathogenic activity of Syzygium cumini essential oil, hydrocarbon fractions and its novel constituents

“…DNA extraction procedure accorded to the instructions, which was given in the kit user's manual DNeasy Plant Mini Kit (Qiagen)/NucleoSpin ® DNA extraction Kit (MachereyNagel, Düren, Germany). The extracted DNA pellet was kept at −20 • C. Two primers [ITS-1 (TCCGTAGGTGAACCTGCGG) (Qiagen) and ITS-4 (TCCTCCGCTTATTGATATGC) (Qiagen)] were used for the PCR amplification of the DNA region encoding 18S, ITS-1, 5.8S, ITS-2, and 28S rDNA (Saroj et al, 2013). Amplification was carried out in a 25 l reaction mixture containing 2.5 l Taq buffer, 1 l dNTP, 0.8 l primers IST1-forward and ITS4-reverse, 3 l fungal genomic DNA, 0.5 l Taq and 16.4 l mili-q water.…”