Functional Analysis of the Human Adenosine Deaminase Gene Thymic Regulatory Region and Its Ability To Generate Position-Independent Transgene Expression

Abstract

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Identification and Characterization of an Alu-Containing, T-Cell-Specific Enhancer Located in the Last Intron of the Human CD8α Gene

“…The first step towards an understanding of the molecular mechanisms involved in CD8 gene regulation requires the identification of cis-acting DNA regulatory elements. In many developmentally regulated and tissue-specific genes such as CD8, DNase I HS have been associated with regions active in transcriptional control, and their appearance has been correlated with both gene expression and the binding of trans-acting regulatory factors (2,4,26,27,30,33,69,82,83). To locate regions potentially accessible to DNA-binding proteins, the chromatin structure surrounding the human CD8ax gene was mapped for sites that are hypersensitive to digestion with DNase I.…”

Fast-Muscle-Specific Expression of Human Aldolase A Transgenes

“…As a result, no expression is detected in several transgenic lines created for one construct, and it is usual to find ectopic activity of promoters (reviewed in references 29 and 43). For a few transgenes, integration-site-independent expression has been observed (1,5,20,22,26,39,44,60). DNA sequences conferring such position-independent expression to linked genes in transgenic animals are generally characterized by a hypersensitivity to nuclease (1,20,22).…”

“…For a few transgenes, integration-site-independent expression has been observed (1,5,20,22,26,39,44,60). DNA sequences conferring such position-independent expression to linked genes in transgenic animals are generally characterized by a hypersensitivity to nuclease (1,20,22).…”