Functional interaction between BDNF and mGluR II in vitro: BDNF down-regulated mGluR II gene expression and an mGluR II agonist enhanced BDNF-induced BDNF gene expression in rat cerebral cortical neurons

Suzuki, Shingo; Koshimizu, Hisatsugu; Adachi, Naoki; Matsuoka, Hiroaki; Fushimi, Satoko; Ono, Junichiro; Ohta, Ken; Miki, Takanori

doi:10.1016/j.peptides.2017.01.007

Cited by 16 publications

(15 citation statements)

References 36 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Previous studies have found antidepressant effects of mGluR2/3 antagonists as evidenced by reduced immobility time of mice in the FST [33, 34]. Moreover, mGluR2/3 increases extracellular dopamine in the nucleus accumbens and dose-dependently enhances cortical BDNF [10, 35], both of which are believed to be cardinal therapeutic effects of other antidepressant therapies. Further, these antidepressant actions were achieved in the present study by intraperitoneal injection of 1 mg/kg, which had been shown to have optimal antagonist efficacy [36, 37].…”

Section: Discussionmentioning

confidence: 99%

Glu-mGluR2/3-ERK Signaling Regulates Apoptosis of Hippocampal Neurons in Diabetic-Depression Model Rats

Zhuo

Han

Zhao

et al. 2019

Evidence-Based Complementary and Alternative Medicine

View full text Add to dashboard Cite

Objectives. Diabetes mellitus is frequently accompanied by depression (diabetes−depression, DD), and DD patients are at higher risk of diabetes-related disability and mortality than diabetes patients without depression. Hippocampal degeneration is a major pathological feature of DD. Here, we investigated the contribution of the Glu−mGluR2/3−ERK signaling pathway to apoptosis of hippocampal neurons in DD model rats. Methods. The DD model was established by high-fat diet (HFD) feeding and streptozotocin (STZ) injection followed by chronic unpredictable mild stress (CUMS). Other groups were subjected to HFD + STZ only (diabetes alone) or CUMS only (depression alone). Deficits in hippocampus-dependent memory were assessed in the Morris water maze (MWM), motor activity in the open field test (OFT), and depression-like behavior in the forced swim test (FST). Terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling (TUNEL) was used to estimate the rate of hippocampal neuron apoptosis. Hippocampal glutamate (Glu) content was measured by high performance liquid chromatography. Hippocampal expression levels of mGluR2/3, ERK, and the apoptosis effector caspase-3 were estimated by immunohistochemistry and Western blotting. Results. DD model rats demonstrated more severe depression-like behavior in the FST, greater spatial learning and memory deficits in the MWM, and reduced horizontal and vertical activity in the OFT compared to control, depression alone, and diabetes alone groups. All of these abnormalities were reversed by treatment with the mGluR2/3 antagonist LY341495. The DD group also exhibited greater numbers of TUNEL-positive hippocampal neurons than all other groups, and this increased apoptosis rate was reversed by LY341495. In addition, hippocampal expression levels of caspase-3 and mGluR2/3 were significantly higher, ERK expression was lower, and Glu was elevated in the DD group. The mGluR2//3 antagonist significantly altered all these features of DD. Conclusions. Comorbid diabetes and depression are associated with enhanced hippocampal neuronal apoptosis and concomitantly greater hippocampal dysfunction. These pathogenic effects are regulated by the Glu−mGluR2/3−ERK signaling pathway.

show abstract

Section: Discussionmentioning

confidence: 99%

Glu-mGluR2/3-ERK Signaling Regulates Apoptosis of Hippocampal Neurons in Diabetic-Depression Model Rats

Zhuo

Han

Zhao

et al. 2019

Evidence-Based Complementary and Alternative Medicine

View full text Add to dashboard Cite

show abstract

“…We have also previously demonstrated that BDNF (100 and 10 ng/mL) led to the phosphorylation of TrkB in this culture system (Suzuki et al . ). The cultures were treated with 100 ng/mL BDNF for 3 days (DIV6–9), and gene expression levels were measured by RT‐qPCR (Fig.…”

Section: Resultsmentioning

confidence: 97%

“…Real‐time quantitative PCR (RT‐qPCR) was carried out as described previously (Suzuki et al . ). Briefly, total RNA was purified from neurons using an RNeasy mini kit (QIAGEN, Valencia, CA, USA) and amplified using the ABI Step One Plus RT‐PCR (Applied Biosystems, Foster City, CA, USA) and One Step SYBR PrimScript RT‐PCR Kit II (Takara Bio, Otsu, Japan) with the following primer sets: Crhbp (forward, 5ʹ‐TGGACTGGACACCTCCAAGAT‐3ʹ; reverse, CRH‐BPr; 5ʹ‐ACTCCGGGATGCTGTTTCTG‐3ʹ) (De Luca et al .…”

Section: Methodsmentioning

confidence: 97%

Corticotropin‐releasing hormone‐binding protein is up‐regulated by brain‐derived neurotrophic factor and is secreted in an activity‐dependent manner in rat cerebral cortical neurons

Adachi

Suzuki

Matsuoka

et al. 2018

Journal of Neurochemistry

Self Cite

View full text Add to dashboard Cite

A recent study revealed that corticotropin-releasing hormone (CRH) in the cerebral cortex (CTX) plays a regulatory role in emotional behaviors in rodents. Given the functional interaction between brain-derived neurotrophic factor (BDNF) and the CRH-signaling pathway in the hypothalamic-pituitary-adrenal axis, we hypothesized that BDNF may regulate gene expression of CRH and its related molecules in the CTX. Findings of real-time quantitative PCR (RT-qPCR) indicated that stimulation of cultured rat cortical neurons with BDNF led to marked elevations in the mRNA levels of CRH and CRH-binding protein (CRH-BP). The BDNF-induced up-regulation of CRH-BP mRNA was attenuated by inhibitors of tropomyosin related kinase (Trk) and MEK, but not by an inhibitor for PI3K and Phospholipase C gamma (PLCγ). The up-regulation was partially blocked by an inhibitor of lysine-specific demethylase (KDM) 6B. Fluorescent imaging identified the vesicular pattern of pH-sensitive green fluorescent protein-fused CRH-BP (CRH-BP-pHluorin), which co-localized with mCherry-tagged BDNF in cortical neurons. In addition, live-cell imaging detected drastic increases of pHluorin fluorescence in neurites upon membrane depolarization. Finally, we confirmed that tetrodotoxin partially attenuated the BDNF-induced up-regulation of CRH-BP mRNA, but not that of the protein. These observations indicate the following: In cortical neurons, BDNF led to gene expression of CRH-BP and CRH. TrkB, MEK, presumably ERK, and KDM6B are involved in the BDNF-induced gene expression of CRH-BP, and BDNF is able to induce the up-regulation in a neuronal activity-independent manner. It is suggested that CRH-BP is stored into BDNF-containing secretory granules in cortical neurons, and is secreted in response to membrane depolarization.

show abstract

“…Immunocytochemical analysis was performed as previously reported 26 . Briefly, striatal cultures were fixed with 4% paraformaldehyde for 30 min at room temperature (RT).…”

Section: Methodsmentioning

confidence: 99%

“…Immunocytochemical analysis was performed as previously reported. 26 Briefly, striatal cultures were fixed with 4% paraformaldehyde for 30 min at room temperature (RT). The cells were permeabilized with PBS containing 0.2% Triton‐X for 2 min and blocked in 5% bovine serum albumin in PBS (PBSB) for 15 min at RT.…”

Section: Methodsmentioning

confidence: 99%

Brain‐derived neurotrophic factor predominantly regulates the expression of synapse‐related genes in the striatum: Insights from in vitro transcriptomics

Koshimizu

Matsuoka

Nakajima

et al. 2021

Neuropsychopharm Rep

Self Cite

View full text Add to dashboard Cite

Aim The striatum, a main component of the basal ganglia, is a critical part of the motor and reward systems of the brain. It consists of GABAergic and cholinergic neurons and receives projections of dopaminergic, glutamatergic, and serotonergic neurons from other brain regions. Brain‐derived neurotrophic factor (BDNF) plays multiple roles in the central nervous system, and striatal BDNF has been suggested to be involved in psychiatric and neurodegenerative disorders. However, the transcriptomic impact of BDNF on the striatum remains largely unknown. In the present study, we performed transcriptomic profiling of striatal cells stimulated with BDNF to identify enriched gene sets (GSs) and their novel target genes in vitro. Methods We carried out RNA sequencing (RNA‐Seq) of messenger RNA extracted from primary dissociated cultures of rat striatum stimulated with BDNF and conducted Generally Applicable Gene‐set Enrichment (GAGE) analysis on 10599 genes. Significant differentially expressed genes (DEGs) were determined by differential expression analysis for sequence count data 2 (DESeq2). Results GAGE analysis identified significantly enriched GSs that included GSs related to regulation and dysregulation of synaptic functions, such as synaptic vesicle cycle and addiction to nicotine and morphine, respectively. It also detected GSs related to various types of synapses, including not only GABAergic and cholinergic synapses but also dopaminergic and glutamatergic synapses. DESeq2 revealed 72 significant DEGs, among which the highest significance was observed in the apolipoprotein L domain containing 1 (Apold1). Conclusions The present study indicates that BDNF predominantly regulates the expression of synaptic‐function‐related genes and that BDNF promotes synaptogenesis in various subtypes of neurons in the developing striatum. Apold1 may represent a unique target gene of BDNF in the striatum.

show abstract

Functional interaction between BDNF and mGluR II in vitro: BDNF down-regulated mGluR II gene expression and an mGluR II agonist enhanced BDNF-induced BDNF gene expression in rat cerebral cortical neurons

Cited by 16 publications

References 36 publications

Glu-mGluR2/3-ERK Signaling Regulates Apoptosis of Hippocampal Neurons in Diabetic-Depression Model Rats

Glu-mGluR2/3-ERK Signaling Regulates Apoptosis of Hippocampal Neurons in Diabetic-Depression Model Rats

Corticotropin‐releasing hormone‐binding protein is up‐regulated by brain‐derived neurotrophic factor and is secreted in an activity‐dependent manner in rat cerebral cortical neurons

Brain‐derived neurotrophic factor predominantly regulates the expression of synapse‐related genes in the striatum: Insights from in vitro transcriptomics

Contact Info

Product

Resources

About