Genotyping of Infectious Bursal Disease Virus Strains by Restriction Fragment Length Polymorphism Analysis of the VP1, VP2, and VP3 Genes

Abstract

SUMMARY. This study aimed to genotype infectious bursal disease virus (IBDV) isolates from the Minas Gerais state poultry industry. RNA was extracted from bursae obtained from field cases without passage or commercial vaccines. Genetic subtyping of IBDV isolates and vaccine strains was carried out by the reverse transcriptase-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP) analysis. A 588-bp fragment in the VP1 gene, an 847-bp fragment in the VP2 gene, and a 320-bp fragment in the VP3 gene were amplified by PCR and digested with restriction enzymes PstI and ScaI (VP1); BamHI, BstEII, and PstI (VP2); and NcoI, ScaI, and XbaI (VP3). Our work shows that complementing the clinical history of the outbreaks with RT-PCR followed by RFLP analysis using PstI for VP1, BamHI for VP2, and XbaI for VP3 allowed an accurate classification of a causative agent as a very virulent IBDV.

The occurrence of Orthoreovirus, Rotavirus and chicken anemia virus in chickens of the poultry industry in Minas Gerais, Brazil

“…The RNA extraction (Trizol) was based on a protocol designed for infectious bursal disease virus (IBDV) (Gomes et al, 2005). The quantified RNA was immediately transcribed (300g) into ARV cDNA using reverse transcriptase (M-MLV, PROMEGA, USA) according to the manufacturer, with primer 5' ATTGAATTCTCTGTTATCTCAACCTTG 3.…”

Effect of maternally-derived antibodies on the performance and immunity of broilers induced by in ovo or post-hatching immunizations with a live vaccine against infectious bursal disease

“…The vaccinal infection was verified in the cloacal bursa of embryos at day 21 of incubation or in chicks 96 hours post-vaccination using reverse-transcription polymerase chain reaction (RT-PCR), with specific primers for the VP1 gene, as previously described (Gomes et al, 2005).…”

A retrospective PCR investigation of avian Orthoreovirus, chicken infectious anemia and fowl Aviadenovirus genomes contamination in commercial poultry vaccines in Brazil

“…Silica adsorbed DNA was eluted by adding 50l TE (5mM Tris-HCl pH 8.0, 0.5mM EDTA pH 8.0) and stored at -20ºC until tested. RNA extraction (Trizol, Invitrogen, USA) was based on a protocol designed for infectious bursal disease virus (IBDV) (Gomes et al, 2005). All DNA and RNA extracts concentrations were estimated (NanoDrop ND-1000) for assay.…”