Heterogeneity of diphtheria toxin gene, tox, and its regulatory element, dtxR, in Corynebacterium diphtheriae strains causing epidemic diphtheria in Russia and Ukraine

Abstract

Diphtheria toxin (tox) and its regulatory element (dtxR) from 72 Corynebacterium diphtheriae strains isolated in Russia and Ukraine before and during the current diphtheria epidemic were studied by PCR-single-strand conformation polymorphism analysis (PCR-SSCP). Twelve sets of primers were constructed (eight for tox and four for dtxR), and three regions within tox and all four regions of dtxR showed significant variations in the number and/or sizes of the amplicons. Two to four different SSCP patterns were identified in each of the variable regions; subsequently, tox and dtxR could be classified into 6 and 12 different types, respectively. The great majority of epidemic strains from both Russia and Ukraine had tox types 3 and 4, and only in a single preepidemic strain isolated in Russia were all eight tox regions identical to those of C. diphtheriae Park-Williams No. 8 (tox type 1). Epidemic strains from Ukraine can easily be identified by dtxR type 5, while the majority of the Russian epidemic strains have dtxR of types 2 and 8. No differences in the tox regions between mitis and gravis biotype strains were observed. However, dtxR types 2, 5, and 8 were identified only in the gravis biotype, and dtxR type 1 was characteristic for the mitis biotype strains. PCR-SSCP is a simple and rapid method for the identification of variable tox and dtxR regions that allows for the clear association of tox and dtxR types with strains of distinct temporal and/or geographic origins.

Tengkawang cultivation model in community forest using agroforestry systems in West Kalimantan, Indonesia

“…Therefore, it is concluded that the currently used vaccine is still appropriate for diphtheria prevention in Indonesia. The result is similar to the finding of Nakao et al (1996), which showed that the decrease in vaccine efficacy was not the primary cause of the large diphtheria outbreak in Russia.…”

Microbiological changes and diversity in autochthonous non-toxigenic Corynebacterium diphtheriae isolated in France

“…The dtxR gene was amplified and sequenced using the protocol from Nakao et al . and the TAQ PCR core kit (Qiagen, Courtaboeuf, France). Amino‐acid sequences were deduced from nucleotide sequences using EMBOSS software (http://www.mobyle.pasteur.fr) .…”

Development of a direct PCR assay for detection of the diphtheria toxin gene

“…PCR. Two sets of primers targeting the A and B subunits of the diphtheria toxin gene were used to detect C. diphtheriae: primers Tox 1 (ATCCACTTTT AGTGCGAGAACCTTCGTCA) and Tox 2 (GAAAACTTTTCTTCGTACCA CGGGACTAA) (248 bp; A subunit) and primers Dipht 6F (ATACTTCCTGG TATCGGTAGC) and Dipht 6R (CGAATCTTCAACAGTGTTCCA) (297 bp; B subunit) (10)(11)(12). These primers were synthesized on a DNA synthesizer (ABI model 380A The Perkin-Elmer Corp., Norwalk, Conn.).…”