HMG1A and PPARG are differently expressed in the liver of fat and lean broilers

Larkina, Tatiana A.; Sazanova, Anna L; Фомичев, К А; Barkova, Olga; Malewski, Tadeusz; Jaszczak, K.; Sazanov, Alexei A

doi:10.1007/s13353-010-0023-z

Cited by 16 publications

(20 citation statements)

References 23 publications

(24 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…This reflects altered nutrient partitioning in high feed efficiency birds which is likely multifaceted, involving changes to metabolic processes in several organs such as reduced adipogenesis in abdominal fat, reduced lipogenesis in the liver, and increased lipoprotein triglyceride hydrolysis in skeletal muscle. Regardless of the specific biological mechanisms, there is evidence that improvements to such performance traits are associated with a shifting of fat metabolism away from the liver and normal adipose depots toward skeletal muscle (Griffin et al, 1989;Larkina et al, 2010;Zhuo et al, 2015). In commercial broiler chickens, selection for large breast muscle partitions more nutrients toward the pectoralis major, which may be particularly susceptible to metabolic perturbations due to its primary composition of type IIB glycolytic muscle fibers (Anderson and Neufer, 2006).…”

Section: Broiler Selection and Wooden Breastmentioning

confidence: 99%

Glucolipotoxicity: A Proposed Etiology for Wooden Breast and Related Myopathies in Commercial Broiler Chickens

Lake

Abasht

2020

Front. Physiol.

View full text Add to dashboard Cite

Wooden breast is one of several myopathies of fast-growing commercial broilers that has emerged as a consequence of intensive selection practices in the poultry breeding industry. Despite the substantial economic burden presented to broiler producers worldwide by wooden breast and related muscle disorders such as white striping, the genetic and etiological underpinnings of these diseases are still poorly understood. Here we propose a new hypothesis on the primary causes of wooden breast that implicates dysregulation of lipid and glucose metabolism. Our hypothesis addresses recent findings that have suggested etiologic similarities between wooden breast and type 2 diabetes despite their phenotypic disparities. Unlike in mammals, dysregulation of lipid and glucose metabolism is not accompanied by an increase in plasma glucose levels but generates a unique skeletal muscle phenotype, i.e., wooden breast, in chickens. We hypothesize that these phenotypic disparities result from a major difference in skeletal muscle glucose transport between birds and mammals, and that the wooden breast phenotype most closely resembles complications of diabetes in smooth and cardiac muscle of mammals. Additional basic research on wooden breast and related muscle disorders in commercial broiler chickens is necessary and can be informative for poultry breeding and production as well as for human health and disease. To inform future studies, this paper reviews the current biological knowledge of wooden breast, outlines the major steps in its proposed pathogenesis, and examines how selection for production traits may have contributed to its prevalence.

show abstract

Section: Broiler Selection and Wooden Breastmentioning

confidence: 99%

Glucolipotoxicity: A Proposed Etiology for Wooden Breast and Related Myopathies in Commercial Broiler Chickens

Lake

Abasht

2020

Front. Physiol.

View full text Add to dashboard Cite

show abstract

“…Previous analysis showed that PPARG expression is more than 3-fold upregulated in "fat"chickens. The primer pairs used in that analysis, however, measured the expression of all gene transcripts (Larkina et al, 2011). The design of transcript specific primers allowed us to measure the expression of each transcript reported for the PPARG gene (GeneID:373928).…”

Section: Discussionmentioning

confidence: 99%

“…Transcript-specific primers were designed using data information from the chicken genome assembly Gallus_gallus-5.0 (GenBank Acc NC_006099.4) using the software PRIMER 3 http://bioinfo.ut.ee/ primer3-0.4.0 (Koressaar & Remm, 2007;Untergasser et al, 2012). The primer sequences are presented in Table 2.GAPDH was used as reference gene as in our previous experiments (Larkina et al, 2011). We applied the following primers for GAPDH expression profiling: GAPDHfw, CCTCTCTGGCAAAGTCCAAG and GAPDHrv, CATCTGCCCATTTGATGTTG.…”

Section: Primer Designmentioning

confidence: 99%

See 1 more Smart Citation

Alternative Transcription of Peroxisome Proliferator-Activated Receptor Gamma in the Liver Is Associated with Fatness of Chickens

Parada

Malewski

Jaszczak

et al. 2018

Braz. J. Poult. Sci.

View full text Add to dashboard Cite

The expression of four transcription variant of peroxisome proliferatoractivated receptor gamma gene (PPARG) (XM_015292931.1; XM_015292932.1; XM_015292933.1 and NM_001001460.1) in the liver of broilers was measured and its correlation with abdominal fat weight and relative abdominal fat content was investigated. The study was conducted with 92 slow-growing crossbred chickens (Cobb males x indigenous Green-legged Partridge female chickens) divided into "fat" and "lean" groups, according to their abdominal fat yield. The NM_001001460.1 transcriptwas upregulated with ratio of means 4.26 (p≤0.01) in the "fat" group in relation to the "lean" group. Expression of this transcript was highly correlated with relative abdominal fat content (0.71, p≤0.01) and abdominal fat weight (0.59, p≤0.01). Two SNPs are located in putative transcription factor binding sites. Mutation-991C>A disrupts PPAR while mutation-884C>T disrupts C/EBP putative binding site. The gene expression analysis of PPARg showed that the expression of the transcripts (NM_001001460.1) was more than four times higher in fat than in lean chickens. These results point out that the peroxisome proliferator-activated receptor gamma NM_001001460.1 transcript could be candidate gene for determination of abdominal fat deposition in the chickens.

show abstract

“…In fatty broiler chickens, cPPAR γ mRNA expression is induced in liver but not in adipose [16]. Because PPAR γ mRNA is induced in adipose tissue of obese mammals [17, 18], the result indicates a divergence of PPAR signal transduction mechanisms between avians and mammals.…”

Section: Regulators Of Cppar Mrnasmentioning

confidence: 99%

Structural Features and Transcriptional Activity of Chicken PPARs (α,β, andγ)

Takada

Kobayashi

2013

PPAR Research

View full text Add to dashboard Cite

While an understanding of lipid metabolism in chickens is critical for a further improvement of food production, there are few studies concerning differences in lipid metabolism mechanisms between chickens and other species at a molecular level. Chickens have three PPAR gene subtypes (α, β, and γ) that function differently from those present in humans and mice. The chicken PPAR-gamma (cPPARγ) gene is shorter than that in humans and lacks a γ2 isoform. Moreover, in serum-free media, cPPARγ shows high transcriptional activity without exogenous ligands. Luciferase reporter assays were used to examine the effect of sera on cPPAR transcriptional activities and showed that adult bovine serum and chicken serum highly activate cPPARα and β functions. Moreover, we found that bezafibrate induces the transactivation function of cPPARβ, but not human PPARδ (human PPARβ ortholog). This ligand selectivity relies on one amino acid residue (chicken: Val419, human: Met444). These results show the possibilities for unique functions of cPPARs on chicken-specific lipid glucose metabolism. As such, a better understanding of the molecular mechanisms of lipid metabolism in chickens could result in higher productivity for the poultry industry.

show abstract

HMG1A and PPARG are differently expressed in the liver of fat and lean broilers

Cited by 16 publications

References 23 publications

Glucolipotoxicity: A Proposed Etiology for Wooden Breast and Related Myopathies in Commercial Broiler Chickens

Glucolipotoxicity: A Proposed Etiology for Wooden Breast and Related Myopathies in Commercial Broiler Chickens

Alternative Transcription of Peroxisome Proliferator-Activated Receptor Gamma in the Liver Is Associated with Fatness of Chickens

Structural Features and Transcriptional Activity of Chicken PPARs (α,β, andγ)

Contact Info

Product

Resources

About