Human placental lactogen, pregnancy‐specific beta‐1‐glycoprotein and alpha‐fetoprotein in serum in threatened abortion

Hertz, J. B.; Schultz-Larsen, Peter

doi:10.1016/0020-7292(83)90047-4

Cited by 16 publications

(9 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…To generate the recombinant PSG17N-Myc-His protein, the N-terminal domain of PSG17 was amplified by polymerase chain reaction (PCR) from full-length PSG17 [8] in pBluescript II KSϩ (Stratagene, La Jolla, CA) with primers 5Ј GAAGATCTAGAGATATGGAG(T/G)TGTC 3Ј (underlined BglII site) and 5Ј TTGGTACCCTCATTT (A/G)TCACAG(C/T) CAGG 3Ј (underlined KpnI site).…”

Section: Generation Of Recombinant Proteinsmentioning

confidence: 99%

“…The serum levels of these proteins reach up to 200 -400 g/ml at term, far exceeding the concentration of human chorionic gonadotropin and ␣ fetoprotein [2]. Treatment of monkeys and mice with anti-PSG antibodies resulted in spontaneous abortion [3,4], and abnormally low levels of PSGs are associated with several serious complications of pregnancy, including fetal hypoxia, fetal growth retardation, pre-eclampsia, and spontaneous abortion [5][6][7][8]. PSG homologues have been identified in mice, rats, and primates [9 -11].…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Binding of pregnancy-specific glycoprotein 17 to CD9 on macrophages induces secretion of IL-10, IL-6, PGE2, and TGF-β1

Waterhouse

Wessells

et al. 2005

Journal of Leukocyte Biology

View full text Add to dashboard Cite

Pregnancy-specific glycoproteins (PSGs) are a family of secreted proteins produced by the placenta, which are believed to have a critical role in pregnancy success. Treatment of monocytes with three members of the human PSGs induces interleukin (IL)-10, IL-6, and transforming growth factor-beta(1) (TGF-beta(1)) secretion. To determine whether human and murine PSGs have similar functions and use the same receptor, we treated wild-type and CD9-deficient macrophages with murine PSG17N and human PSG1 and -11. Our data show that murine PSG17N induced secretion of IL-10, IL-6, prostaglandin E(2), and TGF-beta(1) and that CD9 expression is required for the observed induction of cytokines. Therefore, the ability of PSG17 to induce anti-inflammatory cytokines parallels that of members of the human PSG family, albeit human and murine PSGs use different receptors, as CD9-deficient and wild-type macrophages responded equally to human PSGs. We then proceeded to examine the signaling mechanisms responsible for the CD9-mediated response to PSG17. Inhibition of cyclooxygenase 2 significantly reduced the PSG17N-mediated increase in IL-10 and IL-6. Further characterization of the response to PSG17 indicated that cyclic adenosine monophosphate-dependent protein kinase A (PKA) is involved in the up-regulation of IL-10 and IL-6, and it is not required for the induction of TGF-beta(1). Conversely, treatment of macrophages with a PKC inhibitor reduced the PSG17-mediated induction of TGF-beta(1), IL-6, and IL-10 significantly. The induction of anti-inflammatory cytokines by various PSGs supports the hypothesis that these glycoproteins have an essential role in the regulation of the maternal immune response in species with hemochorial placentation.

show abstract

Section: Generation Of Recombinant Proteinsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Binding of pregnancy-specific glycoprotein 17 to CD9 on macrophages induces secretion of IL-10, IL-6, PGE2, and TGF-β1

Waterhouse

Wessells

et al. 2005

Journal of Leukocyte Biology

View full text Add to dashboard Cite

show abstract

“…Vaginal bleeding i s the commonest complication during the first half of pregnancy. I t occurs in about 15-20% of all pregnancies (1,2), and causes anxiety as to the viability of the fetus and the outcome of the pregnancy.…”

mentioning

confidence: 99%

Can Pregnancy‐Associated Plasma Protein A (Papp‐A) Predict the Outcome of Pregnancy in Women with Threatened Abortion and Confirmed Fetal Viability?

Ruge

Pedersen

SøSrensen

et al. 1990

Acta Obstet Gynecol Scand

View full text Add to dashboard Cite

Depressed pregnancy-associated plasma protein A (PAPP-A) concentrations have been found in patients with threatened abortion, often weeks before spontaneous abortion while the fetus was still alive. In order to extend these findings we have developed a highly sensitive PAPP-A radio-immunoassay and have established a reference range in early pregnancy for PAPP-A between week 7 and week 20 of pregnancy, based on blood samples from 240 pregnant women. The gestational age was determined by ultrasound. PAPP-A was measured in 128 women admitted to hospital because of vaginal bleeding in the 7th to 20th gestational week. The viability of the fetus was confirmed by ultrasonography. The serum values of PAPP-A were significantly lower (p = 0.002) in the group of women with vaginal bleeding than in the group of normally pregnant women. However, with regard to abortion later on, the predictive value of an abnormal blood test on admission was only 18.7%. Serial determinations showed increased PAPP-A values corresponding to the centile expected in the 12 women who aborted, as well as in the 116 women who gave birth. Consequently, the test is of no clinical value in the assessment of the prognosis in patients with symptoms of threatened abortion.

show abstract

“…It is generally agreed that low maternal hPL levels after the 8-10th week are characteristic of threatened abortion with an unsatisfactory outcome and thus provide a guide to prognosis in this condition (Genazzani et al, 1969;Niven et al, 1972;Gartside and Tindall, 1975;Biswas et al, 1980;Hertz and Schultz-Larsen, 1983;Gerhard and Runnebaum, 1984). The low levels would appear to be secondary to death or of damage to the trophoblast, since all placental products are affected in an identical manner (Salem et al, 1984b).…”

Section: Threatened Abortionmentioning

confidence: 95%

Hormones of the Placenta: hCG and hPL

Butt¹,

Chard²,

Iles³

1994

Marshall’s Physiology of Reproduction

View full text Add to dashboard Cite

Human placental lactogen, pregnancy‐specific beta‐1‐glycoprotein and alpha‐fetoprotein in serum in threatened abortion

Cited by 16 publications

References 15 publications

Binding of pregnancy-specific glycoprotein 17 to CD9 on macrophages induces secretion of IL-10, IL-6, PGE2, and TGF-β1

Binding of pregnancy-specific glycoprotein 17 to CD9 on macrophages induces secretion of IL-10, IL-6, PGE2, and TGF-β1

Can Pregnancy‐Associated Plasma Protein A (Papp‐A) Predict the Outcome of Pregnancy in Women with Threatened Abortion and Confirmed Fetal Viability?

Hormones of the Placenta: hCG and hPL

Contact Info

Product

Resources

About