IFNs activate toll-like receptor gene expression in viral infections

Miettinen, Minja; Sareneva, Timo; Julkunen, Ilkka; Matikainen, Sampsa

doi:10.1038/sj.gene.6363791

Cited by 257 publications

(197 citation statements)

References 53 publications

Supporting

Mentioning

182

Contrasting

Unclassified

Order By: Relevance

“…It will be interesting to study whether the TLR7 sensitivity of other immune cell subsets such as myeloid cells also depends on PDC-derived type I IFN. Of note, type I IFNs were shown to induce TLR7 in macrophages (45), and only myeloid dendritic cells generated in the presence but not in the absence of IFN-␣ were reported to express TLR7 (46).…”

Section: Discussionmentioning

confidence: 99%

Plasmacytoid Dendritic Cells Control TLR7 Sensitivity of Naive B Cells via Type I IFN

Berkeredjian-Ding

Wagner

Hornung

et al. 2005

The Journal of Immunology

301

215

View full text Add to dashboard Cite

Detailed information of human B cell activation via TLR may lead to a better understanding of B cell involvement in autoimmunity and malignancy. In this study we identified a fundamental difference in the regulation of TLR7- and TLR9-mediated B cell stimulation: whereas the induction of polyclonal naive B cell proliferation by the TLR7 ligands resiquimod (R848) and loxoribine required the presence of plasmacytoid dendritic cells (PDCs), activation via the TLR9 ligand CpG was independent of PDCs. We found that PDC-derived type I IFN enhanced TLR7 sensitivity of B cells by selectively up-regulating TLR7 expression. In contrast the expression levels of TLR9 and of other TLRs studied remained unchanged. In the presence of type I IFN, TLR7 ligation triggered polyclonal B cell expansion and B cell differentiation toward Ig-producing plasma cells; notably, this occurred independently of T cell help and B cell Ag. Human B cells did not respond to ligands of other TLRs including TLR2, TLR4 and TLR6 with and without type I IFN. In conclusion, our results reveal a distinct regulation of TLR7 and TLR9 function in human B cells and highlight TLR7 and TLR9 as unique targets for therapeutic intervention in B cell-mediated immunity and disease.

show abstract

Section: Discussionmentioning

confidence: 99%

Plasmacytoid Dendritic Cells Control TLR7 Sensitivity of Naive B Cells via Type I IFN

Berkeredjian-Ding

Wagner

Hornung

et al. 2005

The Journal of Immunology

301

215

View full text Add to dashboard Cite

show abstract

“…We were interested in seeing whether epithelial or endothelial cells express these receptors that would enable direct sensing of viral RNA. We have previously shown that IFN-␣ can up-regulate TLR3 and TLR7 gene expression in human macrophages (17). Therefore, we also studied the effects of IFN-␣ and IFN-␤ on TLR expression in epithelial A549 cells and in HUVECs.…”

Section: Tlr3 Tlr7 and Tlr8 Expression And Tlr-stimulated Response mentioning

confidence: 99%

“…Probes for IL-28 and IL-29 were cloned from total cellular RNA obtained from Sendai virus-infected macrophages by RT-PCR using oligonucleotides GTCTCCA CAGGATCCGCAGGCCTT and CAGCCAGGGGGATCCTTTTTTGGG (IL-28), GAAGGCCAGGGATCCCTTGGAAGA and GTGTCAGGTG GATCCAGGGTGGGT (IL-29). The probes for TLR3, TLR7, and TLR8 have been previously described (17). Ethidium bromide staining of rRNA bands was used to ensure equal RNA loading.…”

Section: Rna Isolation and Northern Blot Analysismentioning

confidence: 99%

IFN-α Enhances TLR3-Mediated Antiviral Cytokine Expression in Human Endothelial and Epithelial Cells by Up-Regulating TLR3 Expression

Tissari

Sirén

Meri

et al. 2005

The Journal of Immunology

180

134

View full text Add to dashboard Cite

TLRs play a critical role in early innate immune response to virus infection. TLR3 together with TLR7 and TLR8 constitute a powerful system to detect genetic material of RNA viruses. TLR3 has been shown to bind viral dsRNA whereas TLR7 and TLR8 are receptors for viral single-stranded RNA. In this report we show that TLR7 or TLR8 are not expressed in human epithelial A549 cells or in HUVECs. Accordingly, A549 cells and HUVECs were unresponsive to TLR7/8 ligand R848. TLR3 was expressed at a higher level in HUVECs than in A549 cells. The TLR3 ligand poly(I:C) up-regulated IFN-β, IL-28, IL-29, STAT1, and TLR3 expression in HUVECs but not in A549 cells. An enhanced TLR3 expression by transfection or by IFN-α stimulation conferred poly(I:C) responsiveness in A549 cells. Similarly, IFN-α pretreatment strongly enhanced poly(I:C)-induced activation of IFN-β, IL-28, and IL-29 genes also in HUVECs. In conclusion, our results suggest that IFN-α-induced up-regulation of TLR3 expression is involved in dsRNA activated antiviral response in human epithelial and endothelial cells.

show abstract

“…As a result, it would be interesting to explore the molecular etiology of this pathogenic TLR7 overexpression. Ligation of TLR7 by agonists can stimulate TLR7 expression in a feedforward loop 50 , which implies that high TLR7 abundance might be a sign of the natural stimulation of this receptor by ligands present in the tumor microenvironment. The molecular nature and source of such natural TLR7 agonists remains to be clarified.…”

Section: Discussionmentioning

confidence: 99%

Toll like receptor 7 expressed by malignant cells promotes tumor progression and metastasis through the recruitment of myeloid derived suppressor cells

et al. 2018

View full text Add to dashboard Cite

In non-small cell lung carcinoma (NSCLC), stimulation of toll-like receptor 7 (TLR7), a receptor for single stranded RNA, is linked to tumor progression and resistance to anticancer chemotherapy. However, the mechanism of this effect has been elusive. Here, using a murine model of lung adenocarcinoma, we demonstrate a key role for TLR7 expressed by malignant (rather than by stromal and immune) cells, in the recruitment of myeloid derived suppressor cells (MDSCs), induced after TLR7 stimulation, resulting in accelerated tumor growth and metastasis. In adenocarcinoma patients, high TLR7 expression on malignant cells was associated with poor clinical outcome, as well as with a gene expression signature linked to aggressiveness and metastastic dissemination with high abundance of mRNA encoding intercellular adhesion molecule 1 (ICAM-1), cytokeratins 7 and 19 (KRT-7 and 19), syndecan 4 (SDC4), and p53. In addition, lung tumors expressing high levels of TLR7 have a phenotype of epithelial mesenchymal transition with high expression of vimentin and low abundance of E-cadherin. These data reveal a crucial role for cancer cell-intrinsic TLR7 expression in lung adenocarcinoma progression.

show abstract

IFNs activate toll-like receptor gene expression in viral infections

Cited by 257 publications

References 53 publications

Plasmacytoid Dendritic Cells Control TLR7 Sensitivity of Naive B Cells via Type I IFN

Plasmacytoid Dendritic Cells Control TLR7 Sensitivity of Naive B Cells via Type I IFN

IFN-α Enhances TLR3-Mediated Antiviral Cytokine Expression in Human Endothelial and Epithelial Cells by Up-Regulating TLR3 Expression

Toll like receptor 7 expressed by malignant cells promotes tumor progression and metastasis through the recruitment of myeloid derived suppressor cells

Contact Info

Product

Resources

About