Incidence and antimicrobial susceptibility of Escherichia coli O157:H7 isolates recovered from dairy farms in Amathole District Municipality, Eastern Cape, South Africa

Myataza, Asive; Igbinosa, Etinosa O.; Igumbor, Ehimario; Nontongana, Nolonwabo; Okoh, Anthony I.

doi:10.12980/apjtd.7.2017d7-198

Cited by 6 publications

(6 citation statements)

References 21 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…The guidelines set for faecal coliforms (0.0 CFU/ 100 ml) in domestic water in South Africa [20] and the standard (≤100 CFU/100 ml coliforms) set by the World Health Organisation on the use of wastewater in agriculture and aquaculture [21] were therefore used to assess the quality of the irrigation water samples collected in this study. Accordingly, all the water samples, except those collected from S12 and S17 were unfit for the primary cultivation of farm produce, and consequently potential transmission routes of E. coli O157:H7 to fresh produce, corroborating previous reports [6,22]. This is probably because most irrigation water sources sampled in the present study were surface waters which were vulnerable to various contamination sources including runoff, animal intrusion, discharge of farm and WWTPs effluents.…”

Section: Resultssupporting

confidence: 90%

“…The prevalence of E. coli O157:H7 in irrigation water samples in this study is much higher than the 2.1% reported by Chigor et al [27] in river water used for the irrigation of fresh produce. The prevalence is also higher than the 18.7% reported by Myataza et al [6] in samples collected from portable water channels, irrigation water systems and dairy wastewater in commercial dairy farms. This finding is not entirely surprising as herds of feral cattle, considered as the chief source of E. coli O157:H7 were seen flocking around most of the irrigation water sources.…”

Section: The Prevalence Of Confirmed E Coli O157:h7 Isolatescontrasting

confidence: 57%

“…coli O157:H7 is transferred to agricultural soils when the faeces of cattle and other ruminants are used as manure. The pathogen is also transferred to nearby freshwater bodies including rivers and streams through water runoff [6]. E. coli O157:H7 is spread to the food chain and eventually to human consumers when farm produce grown on contaminated soil comes in contact with this pathogen or when polluted water is used to irrigate the farm's crops.…”

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Prevalence ofE. coliO157:H7 strains in irrigation water and agricultural soil in two district municipalities in South Africa

Iwu

Plessis

Korsten

et al. 2020

International Journal of Environmental Studies

Self Cite

View full text Add to dashboard Cite

We assessed the prevalence of E. coli O157:H7 in irrigation water and agricultural soil samples in two District Municipalities in South Africa using standard culture-based and molecular techniques. Presumptive E. coli O157:H7 counts in irrigation water and agricultural soil samples ranged from 1.00 Log 10 CFU/100 ml to 4.11 Log 10 CFU/100 ml and 2.20 Log 10 CFU/g to 4.21 Log 10 CFU/g respectively (P ≤ 0.05). Thirteen (28%) of the confirmed isolates (n = 46) were Shiga toxigenic and 33 (72%) were Shiga toxin negative. The presence of Shiga toxigenic E. coli O157:H7 strain in irrigation water and agricultural soil samples reported by this study suggests potential risk to food safety and population health.

show abstract

Section: Resultssupporting

confidence: 90%

Section: The Prevalence Of Confirmed E Coli O157:h7 Isolatescontrasting

confidence: 57%

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Prevalence ofE. coliO157:H7 strains in irrigation water and agricultural soil in two district municipalities in South Africa

Iwu

Plessis

Korsten

et al. 2020

International Journal of Environmental Studies

Self Cite

View full text Add to dashboard Cite

show abstract

“…Selanjutnya, pada hasil penelitian lain menyebutkan bahwa masih terdapat isolat E.coli yang sensitif terhadap antibiotik ampisilin, seperti pada hasil penelitian yang dilakukan oleh Mohammed (2014) menyatakan bahwa terdapat sebesar 3,26% E.coli yang masih sensitif terhadap antibiotik ampisilin. Kemudian, pada penelitian lain juga disebutkan bahwa E.coli masih sensitif terhadap antibiotik ampisilin sebesar 51% (Myataza et al, 2017). Namun, tidak hanya itu sudah banyak penelitian lain juga yang menunjukkan bahwa E. coli telah banyak resisten terhadap antibiotik seperti pada antibiotik ampisilin maupun antibiotik seftriakson.…”

Section: Gambar 4 Reaksi Pembentukan Kompleks Eosinunclassified

Isolasi Escherichia coli pada Sumber Air Baku serta Uji Resistensinya Terhadap Antibiotik Ampisilin dan Seftriakson

Suparno¹,

Kasasiah

Ratnasari

2022

JPS

View full text Add to dashboard Cite

Pencemaran sungai Citarum oleh Coliform fecal (Escherichia coli) cukup tinggi. Berdasarkan hasil monitoring pada tahun 2010 menunjukkan bahwa jumlah E.coli di beberapa daerah yang dialiri oleh sungai Citarum melebihi Batas Mutu Air (BMA) yaitu > 1.000/100 ml. Irigasi sungai Citarum merupakan sumber air baku bagi salah satu IPAM di Karawang, yang merupakan sumber bagi sebagian besar pemenuhan air bersih bagi kebutuhan sehari-hari. E.coli dapat menginfeksi melalui kontaminasi air, sehingga dikhawatirkan kondisi ini dapat memicu penyebaran penyakit di masyarakat. Penyakit yang disebabkan oleh infeksi bakteri sering diobati dengan antibiotik. Pemakaian antibiotik telah mengalami peningkatan yang luar biasa selama 5 dekade terakhir sehingga mengakibatkan tekanan selektif yang kuat dan berpotensi memicu kejadian resistensi pada bakteri. Penelitian ini bertujuan untuk mengisolasi E.coli serta menguji resistensinya terhadap antibiotik ampisilin dan seftriakson. Metode yang digunakan dalam penelitian ini meliputi uji pendugaan, uji penegasan, pewarnaan Gram dan pengujian resistensi menggunakan metode Kirby-Bauer dengan standar yang digunakan dalam melakukan kategorisasi mengacu pada CLSI 2020. Pada hasil penelitian didapatkan isolat E.coli yang kemudian dilakukan pengujian resistensi dengan hasil masih sensitif terhadap antibiotik ampisilin dan seftriakson dengan zona hambat masing-masing 26,16 mm dan 33,27 mm.

show abstract

“…FimH TGCTGCTGGGCTGGTCGATG GGGAGGGTGACGGTGACATC 688 [24] PaP GACGGCTGTACTGCAGGGTGTGGCG ATATCCTTTCTGCAGGGATGCAATA 328 [25] Sfa CTCCGGAGAACTGGGTGCATCTTAC CGGAGGAGTAATTACAAACCTGGCA 410 [25] Afa GCTGGGCAGCAAACTGATAACTCTC CATCAAGCTGTTTGTTCGTCCGCCG 750 [25] Aer GGCTGGACATCATGGGAACTGG CGTCGGGAACGGGTAGAATCG 602 [25] FliC TACCATCGCAAAAGCAACTCC GTCGGCAACGTTAGTGATACC 247 [26] IroN ATCCTCTGGTCGCTAACTG CTGCACTGGCAAGAACTGTTCT 846 [27] Usp ATGCTACTGTTTCCGGGTAGTGTGT CATCATGTAGTCGGGGCGTAACAAT 1017 [28] IucD ACAAAAAGTTCTATCGCTTCC CCTGATCCAGATGATGCTC 710 [29] Cdt GAAAATAAATGGAACACACATGTCCG AAAGTAAATGGAATATAAATGTCCG…”

Section: Amplicon Size (Bp) and Referencementioning

confidence: 99%

Determination of virulence and quinolone resistance genes and biofilm production among uropathogenic Escherichia coli strains isolated from clinical specimens in Iran

Tabatabaie

Badamchi

Ohadi

et al. 2021

Reviews in Medical Microbiology

View full text Add to dashboard Cite

Background: Uropathogenic Escherichia coli (UPEC) is the main cause of nosocomial urinary tract infections. The high rates of antimicrobial resistance among UPEC have markedly reduced the remedial options and raised the therapeutic costs and fatality rates. This study analyzed the ability of extended spectrum beta-lactamase (ESBL) production and the presence of plasmid-mediated quinolone resistance genes among UPEC isolates. It also assessed the correlation between plasmid-mediated quinolone resistance genes, biofilm production, and virulence factors among these isolates. Materials and methods:A number of 300 UPEC isolates were recovered from patients with typical clinical signs and symptoms of cystitis, and pyelonephritis, as well as those with asymptomatic bacteriuria. Hemolysis assay, antimicrobial susceptibility testing, and biofilm production were investigated among these isolates. These samples were analyzed by multiplex PCR on genes encoding the pursuits among the virulence factors: type 1 fimbrial adhesin (FimH), pyelonephritis-associated pili (PaP), S fimbriae (Sfa), afimbrial adhesin I (AfaI), hemolysin (hly), aerobactin (Aer), flagelares de la fase 1 (FliC), cytotoxic necrotizing factor 1 (Cnf1), IroN-uptake systems of E. coli D (IucD), cytolethal distending toxin (CDT), and uropathogenicspecific protein (Usp) operon. Results:The current study showed that the presence of virulence genes render the UPEC isolates higher resistance to antibiotics and a higher ability of biofilm production. Conclusion:The fact that the infection can be highly affected by virulence factors of E. coli, let us to conclude that in the case of signs and symptoms of urinary tract infection, it is better to avoid wide use of antibiotics.

show abstract

Incidence and antimicrobial susceptibility of Escherichia coli O157:H7 isolates recovered from dairy farms in Amathole District Municipality, Eastern Cape, South Africa

Cited by 6 publications

References 21 publications

Prevalence ofE. coliO157:H7 strains in irrigation water and agricultural soil in two district municipalities in South Africa

Prevalence ofE. coliO157:H7 strains in irrigation water and agricultural soil in two district municipalities in South Africa

Isolasi Escherichia coli pada Sumber Air Baku serta Uji Resistensinya Terhadap Antibiotik Ampisilin dan Seftriakson

Determination of virulence and quinolone resistance genes and biofilm production among uropathogenic Escherichia coli strains isolated from clinical specimens in Iran

Contact Info

Product

Resources

About