Induced expression of the IER5 gene by γ-ray irradiation and its involvement in cell cycle checkpoint control and survival

Abstract

The immediate-early response gene 5 (IER5) was previously shown, using microarray analysis, to be upregulated by ionizing radiation. Here we further characterized the dose- and time-dependency of radiation-induced expression of IER5 at doses from 0.5 to 15 Gy by quantitative real-time PCR analyses in HeLa cells and human lymphoblastoid AHH-1 cells. A radiation-induced increase in the IER5 mRNA level was evident 2 h after irradiation with 2 Gy in both cell lines. In AHH-1 cells the expression reached a peak at 4 h and then quickly returned to the control level, while in HeLa cells the expression only remained increased for a short period of time at around 2 h after irradiation before returning to the control. After high-dose irradiation (10 Gy), the induction of the IER5 expression was lower and delayed in AHH-1 cells as compared with 2-Gy irradiated cells. In HeLa cells, at this dose, two peaks of increased expression were observed 2 h and 12-24 h post-irradiation, respectively. RNA interference technology was employed to silence the IER5 gene in HeLa cells. siRNA-mediated suppression of IER5 resulted in an increased proliferation of HeLa cells. Cell growth and survival analyses demonstrated that suppression of IER5 significantly increased the radioresistance of HeLa cells to radiation doses of up to 6 Gy, but barely affected the sensitivity of cells at 8 Gy. Moreover, suppression of IER5 potentiated radiation-induced arrest at the G2-M transition and led to an increase in the fraction of S phase cells. Taken together, we propose that the early radiation-induced expression of IER5 affects the radiosensitivity via disturbing radiation-induced cell cycle checkpoints.

Sensitivity of Small Cell Lung Cancer to BET Inhibition Is Mediated by Regulation of ASCL1 Gene Expression

“…HEXIM1 is an inhibitor of the cdk9-cyclin T1 complex for RNA polymerase II transcript elongation, and has been shown to be induced by JQ1 (24,25). IER5 and STK17A are proteins that have been implicated in radiation-induced cell-cycle checkpoint and in apoptosis, respectively (26,27). The upregulation of these genes may be necessary, but not sufficient for the antiproliferative effects of JQ1, although further work will be required to establish this functional assignment to the proteins.…”

Transcriptome Analysis of Porphyrin-Accumulated and X-Ray-Irradiated Cell Cultures under Limited Proliferation and Non-Lethal Conditions

“…Moreover, clonogenic survival was affected by 1 μg/mL PpIX treatment and X-ray irradiation (Figure 3). Transcriptional changes occurred as early as 0.5 h to 2 h after X-ray exposure and peaked shortly thereafter [16,17]. After that time, transcriptional changes were observed 12 to 24 h after irradiation [16,18,19].…”

“…Transcriptional changes occurred as early as 0.5 h to 2 h after X-ray exposure and peaked shortly thereafter [16,17]. After that time, transcriptional changes were observed 12 to 24 h after irradiation [16,18,19]. In each group, the RNA sample was analyzed using a human gene expression microarray consisting of 43,376 oligonucleotide probes.…”

Cytotoxicity of New Metal Porphyrinates Based on Chlorophyll a Derivatives

“…GCTGACGGCTGCATCTGTT CCTGATTTGGACAAGCAGCAA [19] GSR ATCCCCGGTGCCAGCTTAGG AGCAATGTAACCTGCACCAACAA [20] PBP74 TCTGGACTGAATGTGCTTCG ATCCCCATTTGTGGATTTCA [21] GAPDH ACACCCACTCCTCCACCTTTG GCTGTAGCCAAATTCGTTGTCATAC [17] ACTB GCGCGGCTACAGCTTCA CTTAATGTCACGCACGATTTCC [22] *Developed using Primer BLAST online service: http://www.ncbi.nlm.nih.gov/tools/primer-blast/…”