Isolation of polymorphic microsatellite markers in Aporrectodea icterica (Savigny 1826)

Torres-Leguizamon, Magally; Mathieu, Jérôme; Livet, Alexandre; Decaëns, Thibaud; Dupont, Lise

doi:10.1016/j.soilbio.2012.03.020

Cited by 14 publications

(21 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…For instance, the number of alleles was three times higher for A. chlorotica than for A. icterica. This difference is not a particularity of the study because the level of genetic diversity recorded is similar to the results of Dupont et al (2011) for A. chlorotica and of Torres-Leguizamon et al (2012) and Torres-Leguizamon et al (2014) for A. icterica at the landscape/region scale. In our study, A. icterica Table 2.…”

Section: Spatial Genetic Structure Of Earthworms 341 Discussionsupporting

confidence: 54%

“…Its taxonomic status is firmly grounded and the species has distinct morphology, making it easy to recognize (Torres- Leguizamon et al, 2012). Conversely, the A. chlorotica aggregate (Dupont et al, 2011) is composed of several sister species.…”

Section: Biological Modelsmentioning

confidence: 99%

“…Aporrectodea icterica individuals were genotyped at the seven microsatellite loci described in Torres- Leguizamon et al (2012) and one (Ai51) newly identified locus (M. Torres-Leguizamon and L. Dupont, unpubl. data; forward and reverse primer sequences: Ai51F 5' NED-AATCAACTGAACAGGCGTCC and Ai51R TTCGACAGAATGATTGTCCG).…”

Section: Microsatellite Genotypingmentioning

confidence: 99%

“…data; forward and reverse primer sequences: Ai51F 5' NED-AATCAACTGAACAGGCGTCC and Ai51R TTCGACAGAATGATTGTCCG). Loci [including Ai51 (annealing temperature 51°C and 2.5 mM of MgCl 2)] were amplified by the polymerase chain reaction (PCR) following protocols detailed in Dupont et al (2011) and Torres-Leguizamon et al (2012). The migration of PCR products was carried out on a 3130xl Genetic Analyser using the LIZ500 size standard, and alleles were scored using GENESCAN V3.7 and GENOTYPER V3.7 software (Applied Biosystems).…”

Section: Microsatellite Genotypingmentioning

confidence: 99%

See 3 more Smart Citations

Dispersal constraints and fine-scale spatial genetic structure in two earthworm species

Dupont

Grésille

Richard

et al. 2015

Biol J Linn Soc Lond

View full text Add to dashboard Cite

The limited dispersal ability of earthworms is expected to result in marked genetic isolation by distance and remarkable spatial patterns of genetic variation. To test this hypothesis, we investigated, using microsatellite loci, the spatial genetic structure of two earthworm species, Allolobophora chlorotica and Aporrectodea icterica, in two plots of less than 1 ha where a total of 282 individuals were collected. We used spatial autocorrelation statistics, partial Mantel tests of isolation-by-distance (IBD) and isolation-by-resistance (IBR), and Bayesian test of clustering to explore recent patterns involved in the observed genetic structure. For A. icterica, a low signal of genetic structure was detected, which may be explained by an important dispersal capacity and/or by the low polymorphism of the microsatellite loci. For A. chlorotica, a weak, but significant, pattern of IBD associated with positive autocorrelation was observed in one of the plots. In the other plot, which had been recently ploughed, two genetically differentiated clusters were identified. These results suggest a spatial neighbourhood structure in A. chlorotica, with neighbour individuals that tend to be more genetically similar to one another, and also highlight that habitat perturbation as a result of human activities may deeply alter the genetic structure of earthworm species, even at a very small scale.

show abstract

Section: Spatial Genetic Structure Of Earthworms 341 Discussionsupporting

confidence: 54%

Section: Biological Modelsmentioning

confidence: 99%

Section: Microsatellite Genotypingmentioning

confidence: 99%

Section: Microsatellite Genotypingmentioning

confidence: 99%

See 2 more Smart Citations

Dispersal constraints and fine-scale spatial genetic structure in two earthworm species

Dupont

Grésille

Richard

et al. 2015

Biol J Linn Soc Lond

View full text Add to dashboard Cite

show abstract

“…For the I20 and IR populations, sequences were taken from Torres-Leguizamon et al [27] (GenBank accession numbers JN381881–JN381930). Each amplification mixture (25 µl) contained 10 ng DNA, 12.5 µl of Taq PCR Master Mix (Qiagen, Hilden, Germany) and 0.25 µM of each primer.…”

Section: Methodsmentioning

confidence: 99%

Genetic Structure of Earthworm Populations at a Regional Scale: Inferences from Mitochondrial and Microsatellite Molecular Markers in Aporrectodea icterica (Savigny 1826)

et al. 2014

View full text Add to dashboard Cite

Despite the fundamental role that soil invertebrates (e.g. earthworms) play in soil ecosystems, the magnitude of their spatial genetic variation is still largely unknown and only a few studies have investigated the population genetic structure of these organisms. Here, we investigated the genetic structure of seven populations of a common endogeic earthworm (Aporrectodea icterica) sampled in northern France to explore how historical species range changes, microevolutionary processes and human activities interact in shaping genetic variation at a regional scale. Because combining markers with distinct modes of inheritance can provide extra, complementary information on gene flow, we compared the patterns of genetic structure revealed using nuclear (7 microsatellite loci) and mitochondrial markers (COI). Both types of markers indicated low genetic polymorphism compared to other earthworm species, a result that can be attributed to ancient bottlenecks, for instance due to species isolation in southern refugia during the ice ages with subsequent expansion toward northern Europe. Historical events can also be responsible for the existence of two divergent, but randomly interbreeding mitochondrial lineages within all study populations. In addition, the comparison of observed heterozygosity among microsatellite loci and heterozygosity expected under mutation-drift equilibrium suggested a recent decrease in effective size in some populations that could be due to contemporary events such as habitat fragmentation. The absence of relationship between geographic and genetic distances estimated from microsatellite allele frequency data also suggested that dispersal is haphazard and that human activities favour passive dispersal among geographically distant populations.

show abstract

Development and characterization of microsatellite markers in the earthworm Drawida gisti Michaelsen, 1931 and cross-amplification in two other congeners

et al. 2020

View full text Add to dashboard Cite

Isolation of polymorphic microsatellite markers in Aporrectodea icterica (Savigny 1826)

Cited by 14 publications

References 18 publications

Dispersal constraints and fine-scale spatial genetic structure in two earthworm species

Dispersal constraints and fine-scale spatial genetic structure in two earthworm species

Genetic Structure of Earthworm Populations at a Regional Scale: Inferences from Mitochondrial and Microsatellite Molecular Markers in Aporrectodea icterica (Savigny 1826)

Development and characterization of microsatellite markers in the earthworm Drawida gisti Michaelsen, 1931 and cross-amplification in two other congeners

Contact Info

Product

Resources

About